Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                            <---------AHL25(3)
                           --------->AHL25(1)
                           <---------AHL25(1)
                           <---------AHL20(2)
                           --------->AHL20(2)
                          --------->AHL12(2)
                          <---------AHL12(2)                                           <------------
                         <---------AHL12(2)                                          --------->ZAT14
                        --------->AHL20(2)                             xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                        <---------AHL25(3)     <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)   --------->ZAT18
                       --------->AHL20(2)      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3) <xxxxxxxxxxxxxx
                       <---------AHL20(2)  <---------ZAT18             xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                       --------->AHL25(1)  <---------ZAT14             xxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                <---------ZAT14            --------->ZAT18      --------->DAG2     <---------------AtSPL3
                --------->ZAT18    <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)----------->GT1<xxxxxxxxxxxxxx
                <---------ZAT18   --------->ZAT18              ---------->DOF2  <---------AHL20(2)
                --------->ZAT14   --------->ZAT14        <---------ZAT14     xxxxxxxxxxxxxxxxxxxxxxx
               <---------ZAT6 <---------------AtSPL8     <---------ZAT18  xxxxxxxxxxxxxxxxxxx>smallRNA(si3)
              --------------->AtSPL8     <---------ZAT18 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)--------->GATA12  --------------->AtSPL8
              <---------------AtSPL8   --------------->AtSPL8 xxxxxxxxxxxxxxxxxxxx>smallRNA(l2)
   xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)xxxxxxxxxxxxxxx>smallRNA(le3)   <---------------AtSPL8 <-------
   xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)--------->ANAC46<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) ---------
 xxxxxxxxxxxxxxxxxxx>smallRNA(le3)<---------ZAT14 --------->REM1(1)--------->ALFIN1<---------------AtSPL8
--------------AtSPL8   --------->AHL25(3)--------->ZAT14 --------->ZAT14 xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
------------->AtSPL8   <---------AHL25(1)<---------SPL7(1)--------->ZAT6 xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
 
ttttgtacaacatttttagtgtacaaataaataaatgtacacagcgtacacttacatctgtacactaaaagtgttgtacaaatttaagtgtacgaatcaa  24557700
                                     <-------TEIL
                                   <---------ARR11(2)
                                   --------->ARR14(2)                         ------->TEIL
                                   --------->ARR11(2)                --------->AHL25(1)
   ---------->DOF2               --------->ANAC46                    <---------AHL20(3)
 --------->YAB1             --------->ARR11(2)           <---------ZAT6   <---------------AtSPL8
<---------YAB1              --------->ARR14(2)       <---------YAB1  --------->AHL25(2)
---------WRI1               <---------ARR11(2)  --------->ANAC55(2)  <---------AHL20(2)
xxsmallRNA(i)               <---------ARR14(2)  <---------ANAC58     --------->AHL20(2)
xxsmallRNA(s)          ----------->GT1          <---------ANAC58     --------->AHL25(3)
>smallRNA(le3)       --------->ARR14(2)        ------->TEIL          --------->AHL20(3)
--KAN1               <---------ARR14(2)    --------------->AtSPL8    <---------AHL25(1)           --
>RVE1(2)      <----------DOF2--------->KAN1<---------------AtSPL3    <---------AHL25(2)  <---------WOX13(2)
 
actatgaaaagtcactactttgcaaatcgtgaatacccgatacatgtttgtacgtgtttattgttagacgattttattttgtacgttgcattagttagac  24557800
                                    --------->MYB52(1)
                                    <---------WRKY18(1)
                                   ----------->HVH21
                                  <----------DOF2
                                  <---------WOX13(1)
                                 <---------ANAC58
                                 <---------ANAC58
                                 <---------AtLEC2
                           <---------AHL25(1)
                           <---------AHL20(2)
                           --------->AHL25(1)
                           <---------AHL25(3)
                           --------->AHL20(2)                                                   <---
                          --------->AHL25(3)                                                   -----
                         <---------AHL12(3)                                             <---------ARR14(2)
                         <---------AHL12(2)                                             --------->ARR14(2)
                         --------->AHL12(3)                                             --------->KAN4(2)
                        <---------AHL12(2)                                             <---------GLK1(1)
                        <---------AHL25(3)                                             <---------HSFB2a(1)
                       --------->AHL12(3)                                              --------->KAN1
                       --------->AHL12(1)                                              --------->GLK1(1)
                       <---------AHL25(3)                                              <---------KAN4(1)
                       <---------AHL12(3)                                              --------->HSFB2a(1)
                       <---------AHL12(1)                                              --------->KAN4(1)
                       --------->AHL25(1)                                              <---------KAN1
                       <---------AHL25(1)                                              <----------TaMYB80
                       --------->AHL20(2)                                             <---------ARR11(3)
                      --------->AHL20(3)                                              ----------->ARR10
                      <---------AHL25(2)                                              <---------KAN4(2)
                      <---------AHL12(1)                                              <-----------ARR10
                      --------->AHL12(2)                                              <---------RVE1(2)
                      <---------AHL20(1)                  <-----------GT1             ---------->TaMYB80
                      --------->AHL25(2)               <---------ICU4                 --------->ARR11(3)
                      --------->AHL25(3)              --------->ICU4                  --------->ARR14(2)
                      --------->AHL20(1)             --------->WOX13(2)               <---------ARR11(2)
                      <---------AHL20(3)         ----------->GT1             --------->YAB1    -----
                      --------->AHL12(1)      --------->WOX13(2)            <---------YAB5<---------LBD16
                      <---------ARR11(3)      <---------WOX13(2)    <-------TEIL      --------->ARR11(2)
            ------->TEIL--------->AHL12(2)  --------->AHL25(3)   --------->At4g35610  <---------ARR14(2)
        --------->RVE1(2)--------->AHL12(2) --------->AHL25(1)  --------->ANAC58  --------->At4g35610
------->AHL20(2)      --------->ARR11(3)    <---------AHL20(2)  --------->ANAC58  <---------At4g35610
 
ataaaatacaatatgtatgtctgaaaatatttatttgcttgacggttttaatttgtaattttcacctaagctacatggaatcgtaagcggatattcggaa  24557900
                                          ------->TEIL                          --------->ARR11(3)
                                         <---------AtLEC2                       <---------ARR11(3)
                                        <-------TEIL                            --------->RVE1(2)
                                     <------ZmHOX2a(1)                         --------->RVE1(1)
                              <---------AHL12(1)                               --------->CCA1(1)
                              --------->AHL12(1)                             <---------AHL20(3)
                              <---------AHL25(3)                             --------->AHL20(3)
                              --------->AHL25(3)                             --------->AHL12(3)
                              <---------AHL25(1)                           --------->AHL25(1)
                              --------->AHL25(2)                           <---------AHL20(3)
                              <---------AHL25(2)                           <---------AHL25(1)
                              --------->AHL25(1)                           --------->AHL20(2)
                              <---------AHL12(3)                           --------->AHL20(3)
                              --------->AHL20(1)                           <---------AHL20(2)
                              --------->AHL20(2)                           ----------->TBP
                             --------->AHL25(3)                            <---------AHL12(3)
                             <---------AHL12(3)                            --------->AHL12(3)
                             --------->AHL12(3)                        --------->AHL25(1)
                             <---------AHL20(2)                        <---------AHL25(1)
                             <---------AHL25(2)                        <---------AHL25(3)
                             --------->AHL20(2)                        <---------AHL12(3)        ---
                             <---------AHL25(1)                        --------->AHL20(2)       <---
        --------->LBD16      <---------AHL20(3)                        --------->AHL12(1)       <---
        ----------->GT1      --------->AHL20(3)                        <---------AHL12(1)   <-------
      --------->At4g35610<---------HSFB2a(2)                           <---------AHL20(2)   --------
      <---------At4g35610--------->HSFB2a(2)    --------->AHL20(1)     --------->AHL12(3)   --------
------YAB5               --------------->AGL15------->TEIL           <---------AHL12(2)     <-------
---->ANAC58        <---------KAN1  <---------TOE2(3)                --------->AHL12(2)     ---------
---->ANAC58  --------->CCA1(2)<---------AHL20(2)--------->ARR11(3) --------->AHL20(2)   --------->YAB1
 
gcatttggaagcggagaaacgagtttttctaaaaaaattaggatgcatgtatatattggaagtatgtgtataaattatataaatatctaattcataatat  24558000
                      --------->KAN1
                      <---------RVE1(1)
         --------->AHL25(3)
        --------->AHL12(3)
        <---------AHL20(2)
        <---------AHL20(3)
        --------->AHL20(3)
        <---------AHL12(3)                 <---------AHL20(3)
   <---------AHL20(1)<---------RVE1(2)     ----------->TBP                                      ----
   --------->AHL20(1)--------->ARR14(2)    <---------AHL20(2)                             ----------
--------->AHL20(2)   <---------ARR11(3)    --------->AHL20(2)                         <------NtERF2
------>YAB1          --------->ARR11(3)    <---------AHL12(3)                       <---------ANAC58
------YAB5         ----------->ARR10       --------->AHL25(1)                       <---------ANAC46
----TEIL<---------AHL25(2)          --------->ANAC55(2)                             <---------ANAC58
--AHL25(2)       ---------->DOF2    <---------ANAC55(2)                          --------->ALFIN1
->AHL25(2)<---------AHL12(1)        ----------->GT1                            <---------O2---------
->AHL20(3)--------->AHL12(1)    --------->YAB1             <---------KAN1   <-------TEIL <---------ZAT6
--AHL20(3)<---------AHL25(2)   <---------KAN1   --------->YAB5             *TSS<-----------RAV1(1)
>YAB1 <---------AHL20(2)  --------->YAB1   <---------AHL25(1)          ---------->DOF2--------->ALFIN1
 
tcataatatataaaaatttgaaaagatattcagaataataggtgatataaatgtctaatcgaatatagttgtatgaaagttcatgtggcgtagtggtaaa  24558100
                                                               <---------AHL12(2)
                                                              <---------AHL25(1)
                                                              --------->AHL25(2)
                                                              <---------AHL25(3)
                                                              <---------AHL25(2)
                                                              --------->AHL25(1)
                                                              <---------AHL20(3)
                                                              --------->AHL20(1)
                                                              --------->AHL20(2)
                                                              <---------AHL20(2)
                                                              --------->AHL20(3)
                                                             <---------AHL20(2)
                                                             --------->AHL20(2)
                                                             <---------AHL25(1)
                                                             --------->AHL25(1)
                                                             <---------AHL12(3)
                                                             --------->AHL12(3)
                                                             <---------AHL25(2)
                                                             --------->AHL12(1)
                                                             --------->AHL25(3)
                                                             <---------AHL12(1)
                                                           --------->WOX13(2)
                                                           <---------WOX13(2)
                                                         <---------YAB1
                                                         --------->AHL25(1)
                                                         --------->AHL20(2)
                                                         <---------AHL20(2)
                              <------ZmHOX2a(2)         --------->AHL25(3)
                             <---------GATA12       --------->ANAC55(2)                 <---------AHL20(2)
                             --------->GATA12      <---------TOE2(3)             --------->TOE2(3)
                          <-------TEIL        <---------AHL20(2)                ----------->GT1
                       --------->ZAT2         --------->AHL20(2)            --------->KAN1
--------->ANAC58       <---------ZAT2         <---------AHL20(3)--------->WOX13(2)   --------->WOX13(2)
--------->ANAC58      <---------TOE2(2)       --------->AHL20(3)<---------WOX13(2)   <---------WOX13(2)
--------->ANAC46      <---------TOE1(2)     --------->AHL12(2)<---------AHL12(3)--------->YAB1
----->KAN1           <-----------RAV1(2)   --------->AHL12(2)<---------AHL25(3)<---------YAB5
->GT1  <-------TEIL--------->ANAC46   <---------ANAC46  --------->AHL20(2) <---------KAN4(2)--------
>At5g28300       <---------ALFIN1------>ZmHOX2a(1)<-----------GT1       ----------->GT1 --------->AHL20(2)
 
tactcgcaaatgcattctctccacccaggttcgatcctatggagtttatttttttacgttttaattaaattacaggggtataatcgtaaatttaaacaca  24558200
                                         ---------->DOF2
                                --------->ARR14(2)
                                <---------ARR14(2)
                                <---------ARR11(2)
                                <---------MYB52(1)
                                --------->ARR11(2)              <---------DOF5.7(1)
                              --------->DEAR3(1)               <----------DOF2
                             <------NtERF2                    <---------DOF5.7(1)        <---------YAB5
       --------->HSFB2a(2) <---------DEAR3(1)      ---------->ID1             <---------TOE2(3)
  <<<<<<<<<TBF1           --------->ATERF1(1)     <-----------GT1       <---------AHL12(1)
->ANAC46          --------->TOE2(3) ------>ZmHOX2a(1)     <<<<<<<<<TBF1 --------->AHL12(1)
 
acttcttcttcccaaacaaaaccctagtagtcgccgttcctctgtaaagtttttttccttcttcttcttttttgaatttttaagttttgttcatcgtttt  24558300
                           --------->WOX13(1)
                          ------>ZmHOX2a(2)
                         <------ZmHOX2a(2)
                        --------->ARR11(3)
                        --------->RVE1(2)
                        <---------AGP1
                        <---------ARR11(3)
                        --------->GATA12
                        <---------GATA12
                        --------->AGP1
                    ---------->DOF2
           <---------------AGL15                                                   ------>ZmHOX2a(1)
           --------->TOE2(3)                --------->GLK1(1)                  <-----------GT1
           --------------->AGL15           <---------GLK1(2)               <---------DOF5.7(1)
          ----------------->AGL1  --------->YAB1   --------->TOE2(3)       <---------DAG2
          ----------------->AG   <---------ATHB12  --------->TOE1(3)       <----------DOF2
 
ctcattcaacttaaccaaaatgtgaaagatctatcaataatctacagatttctaccttaaaactgaagttttggacaacttttttcctcaccgatttgtt  24558400
                                                                                              <-----
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             <------
                                                                                             <------
                                                                                             <------
                              --------->ARR11(3)                                             -------
                         <---------AHL20(3)                                                  -------
                         <---------AHL20(2)                                                  -------
                         <---------AHL12(3)                                                 --------
                        --------->AHL20(2)                                                  --------
                        --------->YAB1                                                      <-------
                  ------>MYB83<---------ARR11(3)                                            --------
                  ------>MYB46(1)                                                           --------
                 --------->ORA47(1)                                                         --------
                --------->MYB46(3)                                                 <---------HSFB2a(1)
                --------->DEAR4(1)   --------->REM1(1)                             --------->HSFB2a(1)
                --------->DEAR3(1)   --------->ANAC46                   ----------------->AGL1------
                --------->DREB2C(2)<-----------GT1           --------->ARR14(2)    --------->HSFC1(2)
               --------->DEAR3(2)<----------DOF2          <---------MYB59          <---------HSFC1(2)
 <---------MYB52(1)    <---------ATHB12         <---------KAN1      --------->KAN1 --------->KAN1
 
ttctgttttgtcaaaaacaccgaccaataaaaatgtctttacatcaccagcatttctaataccgaattctaaaattccatataagaaaattccaaaaaaa  24558500
                                                           --------->ARR11(2)
                                                           <---------ARR14(2)
                                                         --------->ANAC58
                                                     --------->LBD16
                                                     ------>NtERF2
                                                    <---------ETT(1)
                                                    <---------LBD16
----AHL12(1)                                       <---------LBD16
-->AHL25(2)                                        --------->RAP2.6(3)
---AHL12(2)                                  ------>ZmHOX2a(2)
---AHL25(3)                                 <------ZmHOX2a(2)
---AHL25(2)                                 --------->CCA1(2)
---AHL25(1)                                --------->RVE1(2)
---AHL12(1)                                <---------RVE1(2)--------->CCA1(2)
-->AHL12(1)                                --------->AGP1----------->ARR10
-->AHL12(3)                                --------->ARR11(3)
-->AHL25(1)                                <---------ARR11(2)
->AHL20(2)                                 --------->GATA12<---------ARR11(3)
->AHL25(2)                                 <---------GATA12--------->ARR14(2)
--AHL25(2)                                 --------->ARR11(2)
->AHL25(3)                                 <---------ARR14(2)
->AHL12(3)                                 <---------ARR11(3)
->AHL25(1)                                 --------->ARR14(2)<-------TEIL                 <---------
--->KAN1                                   <---------AGP1--------->ANAC58     ---------->DOF2<------
 
ttccaactctatgctacatagataacaaaaacttcaaaattcaacagatctgattccggcaagatacaccagaactaatgtgaaagtctctaactttcat  24558600
<- Previous    Next ->

AGI:  At1g65960.1   
Description:  GAD2 (GLUTAMATE DECARBOXYLASE 2); calmodulin binding. Identical to Glutamate decarboxylase 2 (GAD2) [Arabidopsis Thaliana] (GB:Q42472); similar to GAD (Glutamate decarboxylase 1), calmodulin binding [Arabidopsis thaliana] (TAIR:AT5G17330.1); similar to glutamate decarboxylase 2 [Brassica juncea] (GB:AAS79669.1); contains InterPro domain Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424); contains InterPro domain Pyridoxal phosphate-dependent transferase, major region, subdomain 1; (InterPro:IPR015421); contains InterPro domain Pyridoxal phosphate-dependent decarboxylase; (InterPro:IPR002129); contains InterPro domai
Range:  from: 24558076    to: 24561094    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.