Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                   <----------DOF2                            <-----
                                          <----------DOF2 <-----------HVH21                  <------
                    --------->YAB1       --------->HSFB2a(1)                                 -------
                   <---------YAB1        <---------HSFB2a(1)  <---------GATA12    <---------GLK1(2)-
               ------->GAMYB             --------->HSFC1(2)  <---------DEAR3(2) --------->LBD16-----
            ----------->RAV1(1)         ------->TEIL      --------->LBD16<---------ALFIN1    -------
      --------->ANAC46   <---------GATA12<---------HSFC1(2)<---------MYB52(1)  --------->HSFB2a(2)<-
---ICU4    --------->MYB46(3)   <---------ICU4    <---------DOF5.7(1)  ------>ZmHOX2a(1)   ------>ZmHOX2a(1)
gtccattacaaacaacaacagcatcataaatctcatcacgacgaactttcttctctttctccgtcgattcaatcctccacttcccgattccttcctccgc  23508600
>NtERF2 --------->TOE2(3)
--->ABI4(1)                                                                  --------->ANAC58
----ATERF1(1)                                                                --------->ANAC46
--->At4g35610                             ------>ZmHOX2a(1)                  <----------ID1
--->LBD16                                --------->TOE2(3)                   --------->ANAC58
----At4g35610                   --------->MYB52(1)                         --------->KAN1
---ALFIN1                       ------>MYB46(1)                           <---------ARR11(2)
-->ANAC46                       ------>MYB83                              <---------ARR14(2)
-------->DEAR3(1)             <---------MYB59                    <---------ARR11(3)              <--
---->RAP2.3(1)   ------->GAMYB--------->AtMYB61                  --------->ARR11(3)<-----------ARR10
-->DEAR3(1)      --------->TOE2(2) ------->GAMYB   <---------ALFIN1       --------->ARR11(2)  ------
--------LBD16   --------->MYB46(3)--------->MYB46(3)     ------>ZmHOX2a(1)--------->ARR14(2) -------
cgccggagaaaccttcacaacctccgtctcaaacctaaccatctcctcaatcccaaactccttagcgaaatctttcaaatacgccaaaacttcgccatga  23508700
                                       <---------MYB52(2)       <---------ZAT18                -----
                                       --------->ANAC58       <---------MYB52(1)             >>>>>>>
               ------>ZmHOX2a(2)       --------->ANAC58      --------->LBD16                 >>>>>>>
              <------ZmHOX2a(2)     --------->MYB46(3)      --------->ANAC46                 <------
              --------->GLK1(1) <---------MYB52(2)       ------->TEIL                        -------
         =============HOX2a_HOX2a  ------->TEIL          --------->ARR14(2)                  -------
   --------->HSFC1(2)           --------->ANAC58         --------->ARR11(2)           <---------ANAC46
   <---------HSFC1(2)           --------->ANAC58         <---------ARR11(2)     <---------MYB52(1)
  --------->GLK1(1)             --------->MYB46(3)       <---------ARR14(2)   <---------ANAC46<-----
  <---------GLK1(1)         --------->LBD16             <---------CCA1(2)   ------->TEIL     >>>>>>>
 <---------ARR11(2)      --------->MYB52(1)      --------->GATA12      <---------ANAC46      -------
 --------->ARR11(2)     <---------ALFIN1    ----------->GT1 --------------->AtSPL8 <---------RVE1(2)
-------LBD16 <---------GATA12 --------->ARR11(2)<---------GLK1(1)<---------ALFIN1 --------->KAN1
--->YAB5 ------>ZmHOX2a(1)<---------LBD16--------->MYB52(1)<---------LBD16<---------ZAT14    >>>>>>>
---->HVH21   --------->GATA12 <---------ARR11(2)--------->GLK1(1)--------->KAN1<-------GAMYB <------
ctcggaaacctcctccgatctctagacacaccggaacgaaccacgaacgggaaatctctgtatccggtacactctcgtgtaccgttgattcgtagagatc  23508800
                                <---------WRKY45  <---------GATA12
                                <---------WRKY12  --------->GATA12
                              <-----------HVH21   <---------ARR11(2)
                            <---------MYB46(3)    --------->ARR11(2)
                            <---------DEAR3(2) ------>ZmHOX2a(2)
->ZmHOX2a(2)               --------->ETT(1)   <------ZmHOX2a(2)
>>GATA-2                 <-----------HVH21   --------->GATA12                       <---------ALFIN1
>>GATA-4              ------>ZmHOX2a(2)      <---------GATA12                    ------>ZmHOX2a(1)
---ARR11(3)          <------ZmHOX2a(2)       --------->ARR14(2)              <---------ARR11(2)
-->ARR11(3)         --------->ARR11(2)       --------->ARR11(2)              --------->ARR11(2)
-->AGP1             <---------GATA12 --------->ANAC55(2)                     <---------ARR14(2)
-ZmHOX2a(2)         <---------ARR14(2)       <---------ARR14(2)              --------->ARR14(2)
>>GATA-3            <---------ARR11(2)       <---------ARR11(2)          <-----------RAV1(2)
-->GATA12           --------->GATA12 --------->ANAC55(1)              <---------ARR14(2)
>>GATA-1            --------->ARR14(2)  --------->MYB52(1)            --------->GATA12
---GATA12      --------->MYB52(1)    --------->ANAC46                 <---------GATA12
tatagacgcttgaatgaacaacggatcgggtcgggtcaacacttaacggatccgattcgacttcatcggtgtaaatccaggttcctcccacttgtttttg  23508900
                                                                  <---------ZAT2   <-------MYC4
                                                             --------->TCP20       ------->PIF5
                                                             --------->ARR14(2)   <---------ANAC46
                                                             <---------ARR14(2)   --------->bZIP60(2)
                                                             --------->ARR11(2)   ==================
                                                             <---------PCF2       <---------O2
                                                             <---------ARR11(2)   --------->TGA1a
                                                            <------NtERF2         <---------PIF3(3)
                                                            --------->ATERF1(1)   --------->O2
                                                           <---------ATERF1(1)    <---------TGA1a
                                                           --------->MYB55(2)     --------->PIF3(3)
                                                           ------>NtERF2         ------>NtERF2     <
                                                           <---------MYB46(3) <-----------HVH21   --
                                                           --------->ABI4(2) --------->RAP2.6(2)  --
                                                          <---------ANAC46   --------->DEAR3(1)   <-
                                                         <---------LBD16     ------->GAMYB <--------
                                                         <---------MYB52(1)  --------->ANAC46     <-
                                             <---------At4g35610  --------->ZAT2<---------ALFIN1  --
                                             ------>NtERF2<---------DEAR3(1)--------->MYB46(3)    <-
                                       <---------ANAC58 --------->LBD16     ================MYC_MYB<
           --------->AtMYB61           ==============================================MYC_MYB      --
          --------->MYB46(3)           ==================================================MYC_MYB <--
<---------HSFB2a(2)                    <---------ANAC58<---------DEAR3(1)   <------------AtMYB77 <--
<---------HSFC1(1)                     --------->TGA1a <---------RAP2.6(2)--------->ARR11(2)    <---
--------->HSFB2a(2)                    <---------TGA1a--------->SPL7(1)   --------->ARR14(2) ------>ZmHOX2a(2)
--------->HSFC1(1)----------->HVH21--------->ARR11(3) <---------LBD16    --------->KAN1<---------ANAC58
tttctcgaaaacgaccactgagtgaccttctcgtcgaagctctcgtgccgctactagtccggcgggtccagcaccgataaccgccacgtggtgtgatctg  23509000
>GATA12     ------->PIF5
>ARR10      <-------PIF5
>HVH21     --------->At4g35610
------->MYB111(1)                                                                 ------------>CBF
--------DEAR3(1)                                                              <---------ICU4
-RVE1(2)   <---------At4g35610                       --------->RVE1(2)        --------->YAB1
--------AtMYB61                         <---------KAN1       <---------ALFIN1 --------->YAB5
------->MYB111(2)               --------->YAB5   --------->YAB5           <---------AHL20(2)      <-
--------MYB46(3)                --------->ATHB12 --------->YAB1           --------->AHL20(2)    ----
------MYB46(1)        <---------ANAC58 --------->RVE1(2)   <---------ALFIN1   --------->ATHB12  <---
------->MYB46(2)      <---------ANAC46 --------->GLK1(2)   --------->ANAC58  <---------YAB1    -----
-------MYB55(1)       <---------ANAC58<---------GLK1(2)--------->YAB1------------>CBF         ------
------P  <-----------RAV1(2) <----------DOF2   ------->TEIL--------->ANAC58  <---------YAB5  -------
------MYB52(1) <------NtERF2 --------------->AGL15------------>CBF  <-----------GT1         <-------
gttggtgataatgcaggtgccatttgtgtgttctttgattagaatctatgaatcacaatcacacacacttgttacaatttatgattacaatgtttttaat  23509100
       <---------ANAC58         <---------MYB52(1)
       <---------ANAC46       ----------->GT1
     <------MYB83           <---------KAN1
     <---------ANAC58      <---------ARR14(2)
     <---------ANAC46      --------->ARR11(2)                 <---------WOX13(1)
     <------MYB46(1)       <---------ARR11(2)                <-------GAMYB
     <---------ANAC58      <---------GATA12                 <---------MYB46(3)
--------YAB5               --------->GLK1(2)               <---------AtMYB61                <-------
----->YAB1                 --------->ARR14(2)          ------->MYC3                    <---------AHL12(2)
------ICU4                 ------->TEIL                <-------MYC3                   <---------AHL20(2)
---->ICU4--------->ALFIN1  --------->GATA12           --------->O2                   --------->AHL20(2)
--->WOX13(2)            --------->ANAC58        <---------WOX13(1)                  <---------YAB1
-->YAB1<---------ANAC58 --------->ANAC46       <------------CBF                <----------DOF2    <-
--AHL20(2)              --------->ANAC58     <---------TOE2(2)<--------P  --------->KAN1    <-------
aatcaatttggtgtgttagaaacttacacgaatctgttattacagacgtagattgccacgttttggttgatagagagaaatgcttttattatataacttg  23509200
                                     ------------>CBF                                            <--
                                   --------->WOX13(1)                                            <--
<------------CBF                 ------------>CBF --------->ICU4      <----------DOF2         <-----
--ANAC58                 --------->At5g28300    --------->WOX13(1)<---------GLK1(1)           <-----
--------YAB5            ----------->GT1       ------------>CBF    --------->GLK1(1)        <--------
--ANAC58       <---------ALFIN1 --------->TOE2(3) <---------YAB5 --------->GATA12  <-----------GT1
tgtcattgtatttcttctccaccgagacagtgaaacatcaatcaatatgagcaatcatcaaactgtgagatttcttttctctcattttgcccttccactt  23509300
   --------->ATHB12                                                                   ----------->HVH21
   --------->YAB5                                                                 <---------ANAC58
  --------->ICU4                                                          --------->DOF5.7(1)  <----
  <---------YAB5                                                         ---------->DOF2       <----
  <---------YAB1                                                       --------->ARR11(3)  <--------
-------ANAC58                                                      ---------->DOF2<---------ANAC58
-------ANAC58                                                --------->ZAT18    <---------ARR14(2)
----DAG2              --------->ETT(2)                       <---------ZAT14  <---------MYB46(3)
-----DOF2             --------->ZAT18    --------->ANAC58    <---------ZAT18 --------->ALFIN1 <-----
-ALFIN1     ---------->ID1               --------->ANAC58 <---------ANAC46--------->DAG2 <----------
tcttgatgattgtttgttttttttgtggacagaagcaggtattgaagcaattggagccatggtgtgaacttaaagataaagtggttcttgtgacaggtgc  23509400
                  <---------GATA12                             <---------ZAT2
===========================HOX2a_HOX2a                         <---------At4g35610
==========================HOX2a_HOX2a                          --------->At4g35610
=====================================HOX2a_HOX2a               --------->ZAT2
------>ZmHOX2a(1) <---------RVE1(2)                         <---------At4g35610
-----ANAC58       <---------ARR11(3)       <-------GAMYB --------->At4g35610
-----ANAC58       <---------ARR14(2)      <---------MYB46(3)--------->At4g35610               <-----
-At4g35610        --------->AGP1 --------->AtLEC2  >>>>>>>>>ARR2              ------>ZmHOX2a(2)
--TEIL           --------->GLK1(1)     <---------ZAT2    <---------At4g35610<---------RVE1(2) ------
-RAV1(2)         <---------GLK1(1)  ---------->DOF2>>>>>>>>>ARR1     <---------ANAC46     XXXXXXXXXX
ttcctctggtatagggagagagatctgtcttgatctatgcaaagctggttgtaagattgtagcagcagctcgtcgtgttgatcgtctcaactctctctgt  23509500
<- Previous    Next ->

AGI:  At1g63370.1   
Description:  flavin-containing monooxygenase family protein / FMO family protein. similar to flavin-containing monooxygenase family protein / FMO family protein [Arabidopsis thaliana] (TAIR:AT1G62620.1); similar to flavin-containing monooxygenase family protein / FMO family protein [Arabidopsis thaliana] (TAIR:AT1G62600.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO70340.1); contains InterPro domain Flavin-containing monooxygenase FMO; (InterPro:IPR000960); contains InterPro domain FAD-dependent pyridine nucleotide-disulphide oxidoreductase (InterPro:IPR013027); contains InterPro domain Pyridine nucleotide-disulphide oxidoreductase, NAD-b
Range:  from: 23506870    to: 23509023    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g63380.1   
Description:  short-chain dehydrogenase/reductase (SDR) family protein. similar to short-chain dehydrogenase/reductase (SDR) family protein [Arabidopsis thaliana] (TAIR:AT1G62610.3); similar to unknown [Populus trichocarpa] (GB:ABK93994.1); contains InterPro domain Glucose/ribitol dehydrogenase; (InterPro:IPR002347); contains InterPro domain Short-chain dehydrogenase/reductase SDR; (InterPro:IPR002198); contains InterPro domain NAD(P)-binding; (InterPro:IPR016040)
Range:  from: 23509306    to: 23510169    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.