Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                              <-----
                                                                                             ------>ZmHOX2a(2)
                                                                                            <------ZmHOX2a(2)
                                                                                            <-------
                                                                                           <--------
                                                                                           ---------
                                                                                           <--------
                                                                                           ---------
                                                                                           <--------
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
       --------->HSFC1(2)                                                                  <--------
       <---------At4g35610                                                                 ---------
       --------->At4g35610                                                                <---------CCA1(2)
       <---------HSFC1(2)                                                              <------ZmHOX2a(2)
       <---------HSFB2a(1)   -------->P                                               <---------GATA12
       --------->HSFB2a(1)<---------MYB52(2)                                          --------->GATA12
       --------->ZAT2    <---------At4g35610                                          --------->ARR11(3)
 ---------->DOF2         --------->At4g35610                                          --------->ARR14(2)
------->CCA1(2)          --------->ZAT2                                  --------->TOE2(3)<---------ARR14(1)
------>ARR11(2)   ----------->RAV1(1)                                    <----------DOF2------>ZmHOX2a(2)
-------ARR11(2)  --------->ANAC46                                      ------->TEIL   <---------ARR14(2)
-------RVE1(2) <---------ALFIN1          <---------YAB1       <---------ARR11(3)    --------->DOF5.7(1)
--WOX13(2)     --------->AtMYB61    ------>ZmHOX2a(1)         --------->RVE1(2)   ---------->DOF2
->WOX13(2)    --------->ANAC46 ------->GAMYB    --------->GLK1(2)  --------->WOX13(2) <---------ARR11(3)
 
gatacaaagcagcttccaccacaacaccagctaaccctcctgttatcagagactctgcaaaacaacatctaatgaactttaaaaacaaagatcggatctt  12400500
     ---------->DOF2                           --------->ANAC55(2)
 --------->YAB1                                --------->ANAC58
-----DOF2                                      --------->ANAC46
--KAN1                         --------->YAB1  --------->ANAC58  <------ZmHOX2a(2)
-ARR11(3)         --------->GLK1(2)            --------->ANAC55(1)
>ARR11(3)         <---------ARR11(3)           <---------ANAC55(2)
-ARR14(2)         <---------ARR14(2)       <------ZmHOX2a(1)    <---------RVE1(2)
>ARR11(2)         --------->RVE1(2)        =============================HOX2a_HOX2a
-ARR11(1)         --------->GATA12      --------->DAG2     <---------ANAC46
>GATA12           --------->ARR14(2)   ---------->DOF2     <---------ANAC58
-GATA12           <---------GATA12 ----------------->AGL1  <---------ANAC58
-RVE1(2)          --------->ARR11(3)--------->TOE2(3)      <---------AtLEC2
-ARR11(2)   ------->MYC3       --------->AtMYB61   --------->ANAC58      <---------ANAC58<---------At4g35610
>ARR14(2)   <-------MYC3      --------->MYB46(3)   --------->ANAC58      <---------ANAC58--------->At4g35610
 
tcaataacaaaagcacatgaaaatctgtttgcaaccataccataaaggacacgcaagaaatggcatggatcatcttgcttaacacagattgcagcacaac  12400600
                          --------->KAN1
                         <---------RVE1(2)
                        --------->YAB1                                      --------->ANAC46
                    --------->YAB5                                          --------->ANAC58
                   <---------YAB5                              --------->ANAC46
                   <------ZmHOX2a(2)                           --------->ANAC55(1) <---------------AtSPL8
            --------->ATHB12                                <-------TEIL    --------->ANAC58
   =====================HOX2a_HOX2a                  <---------MYB52(2)--------->ARR11(2)
   ------>ZmHOX2a(2)--------->ATHB12                --------->ANAC46   --------->ARR14(2)
 <---------GATA12 <---------ARR11(3)                --------->ANAC55(1)------>MYB46(1) <-------TEIL
 <---------AGP1  <------ZmHOX2a(1)                  --------->ANAC58   ------>MYB83--------------->AtSPL3
 --------->ARR11(3)<---------YAB1                   --------->ANAC58--------->MYB46(3) ------->TEIL
 <---------RVE1(2)--------->ARR11(3)    ---------->DOF2 >>>>>>>>>MYB98--------->WOX13(1)
 
tattgatctggttcttgataggatcattgatactcttgaatgctaaagcatctacaagtaacatacacataaccaatccacacaaaaacgtacatttagt  12400700
                                         --------->RVE1(2)
                                       --------->AHL12(1)
                                       <---------AHL12(1)
                                      <---------AHL12(2)       --------->ANAC46
                                <-----------------------TaNAC69(2)
        <---------DOF5.7(1)   --------->DOF5.7(1)              --------->ANAC58
       <---------ATHB12       --------->DAG2                   --------->ANAC58                    <
  <-----------GT1            --------->DOF5.7(1)          --------->ANAC46              ----------->GT1
<---------AHL12(1)          ---------->DOF2             --------->ZAT6                 --------->ALFIN1
 
caatttttcaatctttctctaatggaagaacaaaaggcataaaaaatcaaacctttctaacactaaacgctactaaattcaattttagaggtgggaaatt  12400800
                                                                                            --------
                                                                                       <---------WOX13(2)
                                   <---------HSFB2a(2)                                 --------->WOX13(2)
                                   --------->HSFB2a(2)                               <---------YAB1
                        <---------GATA12                                         ----------->GT1
                        --------->GATA12                                        ----------->GT1
                     <------ZmHOX2a(2)                                         --------->DOF5.7(1)
   --------->ANAC46 --------->GATA12               --------->RVE1(2)           --------->DAG2      >
-----------GT1      <---------GATA12           <-----------GT1               ---------->DOF2<-------
 
tgttaccaggcattgctgtctgagatcgatctatgctactggaaacaatgtcactatccatctaaaaccatttaagaaacaaaaggttaaaattaagctg  12400900
                                                      ------>ZmHOX2a(2)
                                                    --------->ARR14(2)
                                                    <---------ARR14(2)
                                                    --------->AGP1
                                                    --------->GATA12
                                                    <---------AGP1
                                                    <---------GATA12
                                                    <---------ARR11(3)
                                                    <-----------ARR10
                   ----------->GT1          --------->DOF5.7(1)
                 --------->At4g35610  --------->TOE1(2)
                 <---------At4g35610 <---------ANAC55(1)
        --------->KAN1               --------->ANAC55(2)
        <---------AHL20(2)           <---------TGA1a--------->RVE1(2)
       <---------AHL12(1)            --------->TGA1a--------->ARR11(3)
       --------->AHL25(3)            <---------O2  <---------KAN1
       <---------AHL25(1)            <---------ANAC55(2)
     --------->GATA12     =====================bZIP_DOF   --------->MYB46(3)
     --------->ARR11(3)   ---------->DOF2 <---------At4g35610
     <---------ARR11(3) <---------WOX13(2)--------->At4g35610<---------TOE2(3)          --------->ANAC58
->At4g35610    <------ZmHOX2a(1)     <---------ANAC58--------->CCA1(2)                  --------->ANAC58
>>>>>>>>TBF1<-----------RAV1(2)      --------->O2<---------------------WRI1          ------->GAMYB
--At4g35610 <---------LBD16          <---------ANAC58<------ZmHOX2a(2)            ----------->RAV1(1)
 
aagaagaagatttattcaggagcagataataaagaaccatacgtgagaagacgaagatctaaccaaggtagagagactgagagagcaacagaagccagag  12401000
                                                                                                <---
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               <----
                                                                                               -----
                                                                                              <-----
                                                                                              ------
                                                                                            <-------
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                     <-----------GT1                                        --------
                                  <---------AHL12(2)                                        <-------
                                  <---------ICU4                                            --------
                                 <---------AHL12(1)                                         <-------
                                 <---------AHL20(1)                                         --------
                                 --------->AHL20(3)                                        ---------
                                 <---------AHL20(3)                                        <--------
                                 --------->AHL25(2)                                        ---------
                                 --------->AHL25(3)                                        ---------
                                 <---------AHL25(2)                                        <--------
                                 --------->AHL20(1)                                        ---------
                                 --------->AHL12(1)                                        <--------
                                --------->AHL12(2)                                         <--------
                                --------->AHL12(3)                                         ---------
                                --------->YAB1                                         --------->AHL20(3)
                          ----------->GT1                                              <---------AHL20(2)
                         --------->DAG2                       ------------>CBF         <---------AHL25(1)
                        --------->DOF5.7(1)        --------->ARR11(2)                  --------->AHL20(2)
                   <---------------AGL15           <---------ARR11(2)             ------->TEIL<-----
                   --------------->AGL15           ------>MYB83                 --------->YAB5------
                  <-----------------AGL1           --------->MYB52(1)  --------->LBD16 --------->AHL25(1)
                  <-----------------AGL2           ------>MYB46(1)    --------->LBD16  <---------AHL20(3)
     <-----------TGA1  ---------->DOF2           <---------MYB59     <---------LBD16----------->GT1
 <----------DOF2  <-----------------AG <---------YAB1       <-----------GT1  <---------AtLEC2<------
 
agagctttcgtcataaacccttctctaaaaggcaaaaatattactattcaaaccgaaccgaaatcaccaattcccggtttggatgaatattaaaataaat  12401100
       --------->LBD16
      <---------LBD16
     <---------LBD16
    --------->MYB52(1)
------AHL25(3)
------AHL20(2)
------AHL25(1)
----->AHL20(2)
---->AHL20(3)
---->AHL25(3)
-----AHL20(3)
-----AHL20(2)
---->AHL20(2)
----WOX13(2)
--->AHL12(2)
--AHL20(3)
--AHL25(2)
--AHL25(1)
->AHL25(1)
->AHL25(3)
--AHL12(1)
->AHL20(1)
--AHL20(1)
->AHL12(1)
--AHL25(3)
->AHL25(2)
--AHL12(3)
->AHL20(2)
--AHL20(2)
->AHL20(3)
>AHL12(3)
-AHL12(3)
>AHL25(1)
>AHL25(3)                    ----------->GT1                ------>MYB83
-AHL25(1)                <---------YAB1                     --------->RVE1(2)
>AHL12(1)              --------->YAB1                       ------>MYB46(1)                        <
-AHL20(2)           --------->YAB5                         --------->WOX13(1)                     <-
-AHL12(1)          <---------YAB1                         --------->AtMYB61                       <-
>AHL20(2)       --------->ARR11(2)                  ------>ZmHOX2a(2)             <---------WOX13(2)
----AHL12(2)    <---------ARR11(2)                --------->GATA12  --------->MYB52(1)          <---
--->WOX13(2)  <---------MYB46(3)        <------------CBF ------------>CBF------->TEIL     >>>>>>>>>CBP60g
---AHL12(2)<------------CBF<------------CBF       <---------GATA12<---------MYB52(2)      >>>>>>>>>SARD1
 
taatacaaaccgggaattggttacgattagaattgtaaaaatagattgtagttgatctaaaccaatccaacttacgaacctagtgaattggaaatttggg  12401200
                  --------->GLK1(2)
                  --------->RVE1(2)
                --------->KAN4(1)
    --------->AHL12(3)
    <---------AHL12(2)
    <---------AHL12(3)
    --------->AHL25(2)
   <---------AHL25(2)
   <---------ARR11(3)
   --------->ARR11(3)
   --------->AHL25(2)
   --------->AHL20(1)
   <---------AHL12(1)
   <---------AHL20(3)
   --------->AHL12(2)                                <---------AHL20(3)
   --------->AHL12(1)                                --------->AHL25(2)
   --------->AHL20(3)                                --------->AHL20(3)
   <---------AHL20(1)                                <---------AHL12(3)
  --------->AHL12(1)                                 --------->AHL12(3)
  <---------AHL12(1)                                 --------->AHL20(2)
  <---------KAN1<---------KAN1                ------->GAMYB
------ZmHOX2a(1)<---------KAN4(1)       --------->TOE2(3)                      <---------AHL12(2)
-----MYB83     <---------KAN4(2)        --------->AtMYB61         --------->TOE2(3)
-----MYB46(1)--------->LBD16            --------->TOE1(3)       --------->ARR11(3)    --------->YAB5
-----P  <-----------GT1           --------->ANAC46   --------->AHL25(1)       --------->YAB1
 
taggaatatttttacccgaataatctaactcagaaaaacacaacctcaacccaaaaaaaaatagaaataccttgaaaacaaatataaactgactaaactt  12401300
                                                                                                 ---
                              --------->RVE1(2)                                                  <--
         <---------KAN1  <---------RVE1(2)                      --------->RVE1(2)               <---
       ----------->GT1 ----------->GT1           --------->DOF5.7(1)     --------->YAB1       ------
--------->YAB1  ----------->GT1  --------->TOE2(3)   ----------->GT1 --------->MYB46(3)  -----------
 
caaatataacgagtaaaacttgaaaatagataatatccataaactattcgaaaaaatggcaaaacaaaatcaacaatcgcaattctaaaaattggtataa  12401400
<- Previous    Next ->

AGI:  At1g34065.1   
Description:  SAMC2 (S-adenosylmethionine carrier 2); binding. similar to SAMC1/SAMT1 (S-ADENOSYLMETHIONINE CARRIER 1), S-adenosylmethionine transmembrane transporter/ binding [Arabidopsis thaliana] (TAIR:AT4G39460.1); similar to S-adenosylmethionine transporter [Nicotiana benthamiana] (GB:CAF04055.2); contains InterPro domain Mitochondrial substrate carrier; (InterPro:IPR001993); contains InterPro domain Mitochondrial carrier protein; (InterPro:IPR002067)
Range:  from: 12398696    to: 12400861    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.