Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
        --------->RVE1(2)
        <---------ARR11(3)
       <---------CCA1(2)
      --------->ARR11(3)
      <---------AHL20(1)
      --------->AHL25(2)
      <---------AHL25(2)
      <---------ARR11(3)
      <---------AHL25(3)                  <----------DOF2
      --------->AHL20(1)               ------->TEIL  --------->YAB1
     <---------AHL12(3)                <---------ARR11(2)
     --------->AHL12(2)                <---------ARR11(1)                   <---------DOF5.7(1)
     <---------AHL12(2)                --------->ARR14(2)                <---------ALFIN1--------->GLK1(2)
     --------->AHL12(3)                <---------ARR14(2)  <---------ARR11(3)           <---------GLK1(2)
     <---------AHL25(1)                --------->ARR11(2)  --------->ARR11(3)<----------DOF2
     --------->AHL25(1)               <---------CCA1(2)---------->DOF2 <---------At5g28300
--------At4g35610            <-----------GT1       <---------WOX13(2) <-----------GT1  --------->KAN1
------->At4g35610    <---------YAB5   <---------ARR14(1) --------->DOF5.7(1)<---------DAG2     -----
---->KAN1 >>>>>>>>>RAP2.2 <---------MYB46(3)  <---------YAB1  ----------------------->TaNAC69(2)
 
atgctgaaatatatctaaattttagtcatttgttactcttcgtatctttatgctaatgaaaagatagttgtttttaccacctttctggtcaaattctgaa  9595900
                                                      <-------MYC3
                                                      <-------MYC2                              ----
                                                      ------->MYC3                       --------->YAB5
                                        <---------DOF5.7(1)                     --------->ARR11(3)
                                       <----------DOF2------->MYC2              <---------ARR11(3)
                               <-----------HVH21     <---------ANAC58       ---------->DOF2     ----
                            <---------KAN1           <---------ANAC58<----------DOF2    <---------ATHB12
-->TEIL                  <------ZmHOX2a(1) <-----------GT1   <---------ATHB12--------->DOF5.7(1)----
 
cctttggttatctggtttgtctactctaggaatgtgtcatgtcttttttccctcaaacgtgccattcattttctttagtaaaaggtcttcaatgactaca  9596000
                                                                                                  --
                                                                                    <------ZmHOX2a(2)
                                                                                   <---------ARR11(3)
     <---------TOE2(2)                                                             <---------GATA12
  <---------ANAC58                            <------MYB83 --------->ZAT18         --------->GATA12
  <---------ANAC58                            <------MYB46(1)              <---------DAG2       ----
----->ANAC58               ---------->DOF2   --------->MYB59 ---------->DOF2       --------->ARR11(3)
----->ANAC46     <-----------HVH21           --------->MYB111(1)        <-----------GT1         ----
----->ANAC58    <---------ZAT6              <--------P     <---------ZAT14 <----------DOF2  --------
 
agcaagcgtatgttatttagtgtcatttcatagagcgaagccttgtagtaggtcgaatagagtgcaaagaagtgtttactttatcagatcatataacaca  9596100
                                                        --------->AHL25(3)
                                                        <---------AHL25(3)
                                                        --------->AHL20(3)
                                                        --------->AHL12(3)
                                                        <---------AHL20(2)
                                                        <---------AHL20(1)
                                                        --------->AHL20(2)
                                                        <---------AHL20(3)
                                                        --------->AHL25(1)
                                                        <---------AHL25(2)
                                                        --------->AHL25(2)
                                                        <---------AHL25(1)
                                                   --------->AHL20(1)
                                                   <---------AHL20(1)
                                                   --------->AHL20(2)
                                                   <---------AHL20(2)
                                                   <---------AHL12(3)
                                                   --------->AHL12(3)
                                                   <---------AHL25(3)
                                                   --------->AHL25(3)
                                                   <---------AHL25(1)
                                                   --------->AHL25(2)
                                                   <---------AHL25(2)
                                                   --------->AHL25(1)
                                                  <---------AHL20(3)
                                                  --------->AHL20(3)
                                                  <---------AHL12(3)
                                                  <---------AHL20(2)
                                                  --------->AHL20(2)
                                                  --------->AHL12(3)
                                                  --------->AHL25(3)
                                                  <---------AHL25(1)
                                                  <---------AHL25(2)
                                                 --------->AHL12(2)
                                                 <---------AHL12(2)
         <-----------GT1                        --------->AHL20(3)
         <---------AHL20(2)                     <---------AHL20(3)
   --------->ANAC55(2)                          <---------AHL12(2)                     -------------
   <---------ANAC55(2)                          --------->AHL12(2)                --------->HSFC1(2)
------->YAB1             <---------RVE1(2)      --------->AHL25(2)                <---------HSFC1(2)
----->ANAC58         <---------At4g35610       <---------AHL12(1)                --------->ANAC58
----->ANAC58<----------DOF2     <----------DOF2--------->AHL12(1)                --------->ANAC58 <-
->ZAT6------->TEIL   --------->At4g35610     <---------RVE1(2)               --------->CCA1(2)    <-
 
agtatcatgtattttctttttgtttgctgatatttcttttgttactgagataattttattttatttgtattttagtcaagagacaagcttcttagagcat  9596200
                                                                                <-------MYC4
                                                                                ------->MYC4
                                                                                <-------PIF5
                                                                                ------->PIF5
                                                                                <-------MYC3
                                                                                ------->MYC2
                                                                                <-------PIF4
                                                                                ------->PIF4
                                                                                ------->MYC3
                                                                               --------->TGA1a
                                                                               <---------TGA1a
                                                                               --------->ANAC58
                                                                               --------->ANAC46
                                                                               --------->ANAC58
                                                                              ------->TEIL
                                                                             <---------ALFIN1
                                                                         --------->At4g35610
                                <---------ARR11(3)                     ------->MYC3
                        ----------->HVH21                              <-------MYC2
                       <---------ANAC58                                ------->MYC2
                  <-----------RAV1(1)                                  <-------MYC3
                  <---------REM1(1)                                    ------->MYC4
                 --------->ARR11(3)                                    ------->PIF5
                 --------->GATA12                                      <-------PIF5                -
                 <---------GATA12                                     --------->HSFB2a(1)         --
                <---------At4g35610              --------->AHL20(2)   <---------KAN1          ------
        ------->TEIL   <---------ANAC58          <---------AHL20(2)  ------->TEIL             ------
      XXXXXXXXXXXXXXXXXXXX>MIR419      <---------MYB52(1)         --------->MYB46(3)          ------
     <---------ATHB12 <---------At4g35610        --------->AHL12(1)------->GAMYB<-------MYC2<-------
     --------->ICU4   --------->At4g35610    ----------->GT1      <---------MYB52(2)       ---------
-------->WRI1<---------At4g35610--------->ARR11(3) <------------CBF======================MYC_MYB  --
--------ANAC58<-----------RAV1(2)     <-----------HVH21         --------->MYB52(1)    <------------CBF
--------ANAC58================RAV    --------->ANAC46  <-----------HVH21--------->ALFIN1  <---------
 
ttcgagcaatgaatgctgcagatgttgctgaccaagttctccgtcaagttgataaattggtcagaaataacgaacgtgctgcacgtgaaaattggtcagg  9596300
--------->At5g28300                                            --------->KAN4(2)
---------->GT1                                                <---------ICU4
------->ANAC58                                *TSS            --------->YAB5
--->ANAC58                        <---------DOF5.7(1)         --------->KAN1                    <---
--->ANAC58                       <---------DOF5.7(1)         <---------YAB1                   ------
--->AtLEC2                       <---------DAG2              <---------YAB5          --------->YAB1
----RAV1(2)               <-----------GT1   --------->ZAT6 --------->YAB1           <---------YAB1
>WRKY18(1)           <----------DOF2   <----------DOF2  <----------DOF2      <---------O2     ------
------->ANAC58 <---------YAB5    <----------DOF2 --------->REM1(1)           --------->O2   <-------
--HVH21        <---------YAB1 ------>ZmHOX2a(1)  --------->ANAC46<---------ICU4   --------->YAB1<---
 
caaggtaaatgttttgttttcattctttatttcctactttttctttagctctacatcacctttgatcattctgaccagtaacgtctcatgataaacctac  9596400
                                                 --------->MYB52(1)
                                            ---------->DOF2
                                         <-----------HVH21
                                       ------>ZmHOX2a(2)
                                      <---------KAN1--------->YAB5
                                      <---------At4g35610
                                      --------->At4g35610
                                     <---------ARR11(2)
                                     --------->ARR11(2)
                                     <---------ARR14(2)
     <---------KAN1                  --------->ARR11(3)
    <---------KAN4(2)                <---------ARR11(3)         --------->LBD16
-------DOF2                          --------->ARR14(2)        <---------ALFIN1
>MYB46(1)           <---------YAB5   <---------RVE1(2)         <-----------RAV1(2)<---------ATHB12
>MYB83<-----------GT1   --------->YAB1<------ZmHOX2a(2) --------->KAN1    <---------YAB1      <-----
--MYB59  <-----------RAV1(2)         <---------GATA12   <---------ICU4   <---------------------WRI1
------DAG2    --------->YAB5         --------->GATA12  <---------KAN1  --------->ICU4      <--------
 
ttttcagaataaccaggtgattagtcatcaaaattcttgggatctgtcaaagaaacgaataatgccccagggtgaagatgatacaatcaatggagaggtt  9596500
                   --------->ZAT6
                 --------->YAB1
           --------->ANAC58            --------->ANAC58                                        -----
           --------->ANAC46            --------->ANAC58                                    <--------
           --------->ANAC58         -------->ZAP1                                          ---------
          --------->SPL7(1)      --------->WRKY12                                          <--------
      --------------->AtSPL8     ----------->HVH21              <---------REM1(2)          ---------
      <---------------AtSPL3  ------->TEIL                ------->TEIL                    <---------KAN1
---P <---------ANAC46       <-------TEIL<---------ZAT2  --------->YAB5                    <---------GLK1(1)
-AtMYB61<---------SPL7(1)  --------->AtLEC2            <---------ATHB12                   --------->GLK1(1)
 
gctccgaagcgcgtacgccataatactaacatgcatttgacccagcaagttcaaacaaatgaatccctacagggacctgtctctatcaatggcatttcct  9596600
                                                            <----------DOF2
                                                           <---------ANAC58
                                                       <------MYB83
                                                      <---------MYB46(3)
                                                     <---------WOX13(1)
                                                   <---------ICU4
                                                   -------->ATHB1
                                                   --------->YAB5
                                                   --------->ATHB12
                                                   <------------ATHB5
        <----------DOF2                            --------->YAB1                       ------>NtERF2
       <---------DOF5.7(1)                        <---------YAB5                     --------->ZAT2
    ------->GAMYB                    --------->MYB46(3)<------MYB46(1)               --------->At4g35610
   --------->MYB46(3)       --------->ZAT14       <---------YAB1<---------ANAC58     <---------ZAT2-
   <---------YAB5           <---------ZAT14       <---------ATHB51                   <---------At4g35610
->ZmHOX2a(1)           --------->WRKY12           --------->ICU4<---------ANAC58    <---------ARR14(2)
-ARR14(2)              --------->WRKY38(1)        <---------ATHB12                  --------->ARR14(2)
>ARR11(2)            --------->At4g35610       ------------>ATHB5         <------ZmHOX2a(1) <-------
-ARR11(2)            <-------GAMYB   <---------KAN1<--------ATHB1  --------->At4g35610--------->ATERF1(1)
>ARR14(2)            <---------At4g35610  ----------->GT1  <---------ANAC58        <------ZmHOX2a(1)
 
ctggtaaccatctttcggacagtgagttgactccagtggaacaaatggtttcaatgattggtgctttgcttgctgaaggagacagaggagctgcctcact  9596700
                                     <---------RVE1(2)
                                  <---------ANAC46
                                 <---------At4g35610
                              <---------ANAC58
                            <---------YAB1
                          <---------GLK1(1)
                          --------->GLK1(1)                                                  -------
                          --------->KAN1                                                     <------
                          --------->CCA1(2)                                        <-------MYC3
                         <---------ARR14(2)                                        ------->MYC3
                         <---------ARR11(2)            <---------KAN1             --------->O2
                         <---------ARR11(3)          --------->YAB1               <---------O2
                         --------->ARR14(2)        --------->ANAC58               --------->TGA1a
                         <---------RVE1(2)         --------->ANAC58               <---------TGA1a
    <---------YAB1       --------->ARR11(2) --------->YAB1                       <---------TOE1(2)
-------->KAN1          --------->LBD16   ----------->GT1                        <---------ALFIN1  <-
--ALFIN1         <-------TEIL <---------ANAC58 --------->YAB1                 <-----------------AGL1
 
tgaaattctcatttctaagcttcatccagatatgcttgctgatatagtaataacaagcatgaaacacttgcctagtacccctcccacgttggcaagttca  9596800
<- Previous    Next ->

AGI:  At1g27595.1   
Description:  similar to ESP4 (ENHANCED SILENCING PHENOTYPE 4), binding [Arabidopsis thaliana] (TAIR:AT5G01400.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO61552.1); contains domain PTHR15245:SF6 (PTHR15245:SF6); contains domain PTHR15245 (PTHR15245)
Range:  from: 9596347    to: 9603242    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.