Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
             <---------RAP2.6(3)
             ------>NtERF2
            --------->RRTF1(2)
            <---------ETT(1)
            ----------->HVH21
            --------->RAP2.6(2)
            --------->RAP2.3(3)
            --------->DREB2C(2)
            --------->RAP2.3(2)
            --------->DEAR4(1)
            --------->DEAR3(1)
            --------->RRTF1(3)
            --------->At1g77200                                                                   --
           --------->ORA47(2)                      ------>ZmHOX2a(2)                              --
           --------->RAP2.3(1)                    >>>>>>>>>>>>>>>>>LFY                            --
           --------->ERF1                        <---------GATA12                                 --
          --------->At4g35610           --------->ZAT2        <---------MYB52(1)      <---------MYB52(1)
          --------->LBD16 --------->LBD16        --------->GATA12        <---------ZAT18        <---
          <---------At4g35610         <---------ALFIN1      <---------ANAC58         <-----------HVH21
        <---------LBD16   <---------HSFB2a(2) <--------P    <---------ANAC58      <---------At4g35610
 <---------ARR11(3)       --------->HSFB2a(2)<-------GAMYB  <---------ANAC46     ------->TEIL   <---
--->ZmHOX2a(2)           <---------LBD16----------->RAV1(2)<---------DEAR3(1)  ---------->DOF2  ----
---->HVH21------>NtERF2 <---------LBD16<XXXXXXXXXXXXXXXXXXXXMIR869.1     --------->PCF2 --------->MYB59
 
tcgagatgttttccgccgacaagtttgtccgggaagagacaacacctgggttgatccaatgggccgtgaggtttagggcccatgaagctgttaggcctta  9428600
      <-----------HVH21
     ------->GAMYB
     --------->DEAR3(1)
    --------->DEAR3(2)
    <------------AtMYB77
    --------->MYB46(3)
   -------->P
   ------>MYB46(1)                                                         --------->YAB5
   ------>MYB83                                                           --------->ICU4
------->ANAC58                                                       --------->ANAC58
------->AtLEC2                             <---------TOE2(3) --------->HSFC1(2)
------->ANAC46                        <------ZmHOX2a(1)     <---------ARR14(2)
------->ANAC58                 --------->ANAC58             --------->ARR14(2)               -------
------ANAC58                 ---------->DOF2 <------ZmHOX2a(1)       --------->ANAC58       <-------
------ANAC58    --------->ZAT18--------->ANAC58 ----------->GT1    ---------->DOF2        <---------KAN1
----->KAN1     <-----------HVH21  ---------->DOF2       <---------------------WRI1  <---------LBD16
 
catgccaaccgtcgaagaggtcactgaattagtaaagcaaaggattgaggagggttttaagcgaaacttcaaaagcaatgtttcgacttcggaatatgaa  9428700
               --------->AHL20(2)
               --------->AHL20(3)
               <---------AHL20(3)
               <---------AHL20(2)
               <---------AHL25(1)
             <---------AHL12(2)
            --------->AHL20(3)
            <---------AHL20(1)
            --------->AHL12(1)
            --------->AHL25(2)
            <---------AHL25(2)
            <---------AHL20(3)
            <---------AHL12(1)                                                                  <---
            <---------ARR11(3)                                                                  <---
            --------->ARR11(3)                                                         <----------DOF2
            --------->AHL20(1)                                                      <---------ARR11(3)
   <---------YAB1                      <---------ANAC58                            <---------CCA1(2)
  <---------TOE2(3)   <----------DOF2  <---------ANAC58           <-----------GT1  <---------GLK1(1)
-->YAB5    --------->AHL12(1)    <---------YAB1               <---------RVE1(2)   <---------RVE1(2)
--YAB1     <---------AHL12(1)  <-----------GT1          ------->TEIL <----------DOF2--------->ARR11(3)
 
tagttgatgtttgaatattttaatgctttctgtattactattttgtgccaaaacatatgcacttggatttttctttcttctatttgatatctttgtgttt  9428800
                                                                                   <---------YAB5
                                                                                  --------->AHL12(2)
                                                                                  --------->WOX13(2)
                                                                                 --------->MYB52(2)
                                                                             <------MYB83
                                                                             ----------->GT1
                                                                        <---------AHL20(2)
                                                                       <---------YAB1
                                                                       --------->AHL25(3)
                                                                      --------->AHL12(2)
                                                                      --------->AHL12(3)
                                                                      --------->AHL20(3)
                                                                      <---------AHL20(3)
                                                                      <---------AHL25(2)
                                                                    --------->AHL25(3)
                                                                    --------->AHL25(1)
                                                                    --------->AHL20(3)
                                                                    <---------YAB1<---------WOX13(2)
                                                                    <---------AHL20(2)
  <---------RVE1(2)                         --------->YAB1          <---------AHL20(3)
<---------YAB5                 <----------DOF2     <-----------GT1  --------->AHL20(2)
------YAB1            <---------MYB52(1)   <-------TEIL        <-------TEIL  <------MYB46(1)     ---
------AHL20(2)  <---------CCA1(2)     <-----------GT1   <---------KAN1--------->AHL25(2)--------->AHL20(2)
 
ttattgattttgaagcctcatttctcttagttttctttatttcacattcatgttttagcatatagtttcatattattatttggttaattgtttatatata  9428900
                   <---------WOX13(2)
                   --------->WOX13(2)
                  --------->ATHB12
                 <---------YAB1
               --------->YAB1
               --------->TOE2(3)                           <---------ANAC55(2)
           --------->AHL12(1)                              --------->ANAC55(1)
           <---------AHL12(1)                              --------->ANAC55(2)
           <---------AHL25(3)                              --------->O2
          <---------AHL20(3)                               --------->ANAC58
          --------->AHL20(3)                               --------->ANAC46
          <---------AHL25(2)                               --------->bZIP60(2)
          --------->AHL25(2)                               <---------TGA1a
         --------->AHL12(2)                                --------->ANAC58
         <---------AHL12(2)                                <---------O2
       <---------AHL20(3)                                  --------->TGA1a
       --------->AHL20(2)                                 <-----------STF1
       --------->AHL20(3)                          --------->DOF5.7(1)
       <---------AHL12(3)                     ----------------->AGL2
       <---------AHL20(2)                     ----------------->AG
       <---------AHL25(1)                     ----------------->AGL1
       --------->AHL25(2)                   --------->ANAC58<-----------HVH21
       <---------AHL25(3)                   --------->ANAC58<-----------TGA1
       --------->AHL25(3)                  --------->DOF5.7(1)             --------->ANAC46
       <---------AHL25(2)                 ---------->DOF2<---------ALFIN1  --------->ANAC55(1)
       --------->AHL25(1)            <----------ID1--------->DAG2          --------->YAB1
       --------->AHL20(1)         --------->DAG2  ===================bZIP_DOF
    <---------AHL12(2)            --------->DOF5.7(1) <----------ID1       --------->ANAC58
  --------->AHL25(1)             ====================================bZIP_DOF     --------->ANAC46
  --------->AHL20(2)             --------->DOF5.7(1)--------->DOF5.7(1)    ----------->GT1       <--
  <---------AHL12(3)             ---------->DOF2  --------->DOF5.7(1)      --------->ANAC58      ---
  <---------AHL20(3)            ---------->DOF2   ---------->DOF2      --------->KAN1--------->CCA1(2)
  --------->AHL20(3)<---------WOX13(1)    ===========================bZIP_DOF     --------->ANAC58 -
-------->GT1   --------->TOE1(3)=====================================bZIP_DOF     --------->ANAC58<-
 
ctgaaaaaaataaaataatcttaattggtttatccaaaaggcgagaaaagccaaaaagggacacgtcatactactcactcgtaacaagacacgagttttt  9429000
                               <----------ID1
                          --------->YAB5
                         ----------->TGA1
                       --------->YAB5
                     <---------WOX13(1)
            <------------CBF  <---------------------WRI1                              --------->YAB1
  --------->YAB1    <------------CBF--------->ANAC46                              --------->MYB46(3)
  <-----------GT1  --------->ATHB12 --------->ANAC58                         <---------ATHB12
-------AHL20(2)   <---------YAB5    --------->AtLEC2                       --------->WOX13(1)
------>AHL20(2)  <---------WOX13(1) --------->ANAC58                     <------ZmHOX2a(2)
-------->YAB1   <---------ANAC58 *TSS --------->YAB1         ===================HOX2a_HOX2a
--------AHL20(2)<---------ANAC58------>NtERF2                ------>ZmHOX2a(1)--------->YAB1
 
tttaataacaaaatgaattgagtgattgatgacgacgacaagcaaaatgcaaaatcgctgtctccttcatgcttcgatcaatcaaaccatcatcaaaccc  9429100
                                                                                          <-------GAMYB
                                                                                        <------NtERF2
                                                                                      --------->ALFIN1
                                                                                    <---------ANAC58
                                                                                    <------MYB46(1)
                                                                                    <---------ANAC46
                                           <---------At4g35610                      <---------ANAC58
           ------>MYB46(1)                 <---------ZAT2                           <------MYB83
           ------>MYB83         <------NtERF2                                      <---------MYB46(3)
          ----------->RAV1(1)  --------->RAP2.6(2)                                 <---------DEAR3(1)
          --------->MYB52(1) <---------At4g35610                                   --------->MYB46(2)
         --------->AtMYB61   --------->At4g35610--------->ZAT14                    --------->MYB55(2)
   --------->DOF5.7(1)    <------ZmHOX2a(1)--------->At4g35610                 --------->ALFIN1  ---
 ---------->DOF2     ------>ZmHOX2a(1)     --------->ZAT2    ----------->GT1--------->GATA12    <---
 
ataagaaagagaccaacagtgttcctgtaggaagcggcaaacttgcagctctgttctcttgaaatggagaaaacagtgagatgtgttcggtggggttatg  9429200
                           --------->ANAC58                      --------->YAB1
                           --------->ANAC46                      --------->KAN1
                        --------->DEAR3(1)                       <---------ICU4
                 <---------ANAC46                               <---------ATHB12
                 <---------ANAC58                              --------->WOX13(2)
                 <---------ANAC58                              <---------WOX13(2)
          ----------->RAV1(2)     <-----------GT1     <-------TEIL<-----------GT1
          <---------At4g35610  <---------WOX13(2)    <---------ARR11(3)
        <---------DOF5.7(1)--------->ANAC58          --------->ARR14(2)        <---------YAB5
   <-----------GT1   <---------AtLEC2   ------>ZmHOX2a(1)<<<<<<<<<TBF1   <----------DOF2--------->YAB1
-------->GT1   <---------YAB1  --------->WOX13(2)    <---------ARR14(2) <---------DOF5.7(1)
------TOE2(3)<---------At4g35610 --------->AHL20(2) <---------GLK1(2)  <---------DOF5.7(1)
 
aggttaatacctcttctgatgcttgcatcgacgcaattaactcctattttcaacaggttcttcttcaattatccctcttttagtcactgaaacatcatga  9429300
                                             <---------WOX13(2)
                                             --------->WOX13(2)
            ----------->GT1    --------->GATA12
            <---------MYB46(3) --------->ARR11(3)                                             ------
        <---------KAN1         <---------ARR11(3)                                          ---------
        <---------HSFB2a(1)    <---------GLK1(2)                                         ---------->DOF2
      <<<<<<<<<<<<<<<<<LFY     <---------RVE1(2) <---------TOE2(3)<---------GATA12    <---------TOE2(3)
  <---------WOX13(1)         <---------TOE2(3)   <---------TOE1(3)--------->GATA12<---------WOX13(2)
--------->ATHB12 --------->REM1(1)     --------->AtLEC2<-----------GT1            --------->WOX13(2)
 
aattgattggaacattggttacaacagggcttaagattttcgatgcaaaattgaggtttttctctatggaatctagatggggtttcattaagaaaagtat  9429400
                --------->AHL20(2)
                --------->YAB1
     --------->KAN1
    <---------AHL20(2)
 --------->AHL12(3)
 --------->AHL20(2)
 <---------AHL20(2)
 <---------AHL12(3)
 --------->AHL25(1)
 --------->AHL20(3)
 <---------AHL25(3)                                                                                -
 --------->AHL25(2)                                                                                -
 <---------AHL20(3)                                                                               <-
--------->AHL25(3)                                                                             <----
--------->AHL25(2)                                                                            <-----
<---------AHL20(1)                                                                        ------>ZmHOX2a(2)
<---------AHL12(1)                                                                       <------ZmHOX2a(2)
<---------AHL25(2)                                       --------->ANAC55(2)            <---------ARR11(3)
--------->AHL12(1)         <---------ANAC58              <---------ANAC55(2)            <---------GATA12
--------->AHL20(2)         <---------ANAC58      ------->TEIL                           --------->ARR11(3)
<---------AHL20(2)   <---------AHL20(2)       <---------YAB1                        <-----------GT1-
--------->AHL25(1)   <---------AHL25(3)    <---------AHL20(2)                     --------->WOX13(2)
--->RVE1(2)    <---------ATHB12        <---------ICU4   <-------TEIL              <---------WOX13(2)
-->GT1       --------->WOX13(1)       <---------YAB5  <---------RVE1(2)     ------->TEIL--------->GATA12
 
caatttttttattcttcaatcaaatttatggctagggtttgatcattttatgaatttgatacgtttttgagtcactatgtagcttaattacgatcttgtg  9429500
<- Previous    Next ->

AGI:  At1g27140.1   
Description:  ATGSTU14 (GLUTATHIONE S-TRANSFERASE 13); glutathione transferase. similar to ATGSTU13 (GLUTATHIONE S-TRANSFERASE 12), glutathione transferase [Arabidopsis thaliana] (TAIR:AT1G27130.1); similar to unknown [Populus trichocarpa] (GB:ABK95417.1); contains InterPro domain Thioredoxin-like fold (InterPro:IPR012336); contains InterPro domain Glutathione S-transferase, C-terminal-like (InterPro:IPR010987); contains InterPro domain Thioredoxin fold (InterPro:IPR012335); contains InterPro domain Glutathione S-transferase, N-terminal (InterPro:IPR004045); contains InterPro domain Glutathione S-transferase, C-terminal (InterPro:IPR004046)
Range:  from: 9427845    to: 9428703    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At1g27150.1   
Description:  binding. similar to binding [Arabidopsis thaliana] (TAIR:AT1G27110.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO41008.1); contains InterPro domain Tetratricopeptide-like helical; (InterPro:IPR011990)
Range:  from: 9429034    to: 9432261    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.