Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                    <---------AHL12(2)                     ---------
                                                    --------->AHL12(3)                     <--------
                                                    <---------AHL12(3)           ----------->RAV1(1)
                                                    --------->AHL20(2)          --------->ANAC46
                                                  --------->AHL20(3)          --------->ANAC46
                                                  <---------AHL12(3)          --------->ANAC58
                                                  <---------AHL20(3)          --------->ANAC58
                                        --------->YAB1 --------->AHL20(1)   ----------->RAV1(1)   --
     ----------->GT1               --------->MYB46(3)<---------AHL12(2)     <---------ALFIN1 <------
 <---------AHL20(2)           ----------->GT1     --------->AHL25(1)     --------->ANAC46 <---------YAB1
--------->GT1              <---------ARR11(2)     --------->AHL20(2)   <-----------GT1    ----------
-AHL20(2)               <---------REM1(1)    ----------->GT1  ----------->GT1 <---------ALFIN1------
ttagtaaattgttaatctattctaatggtgtaactgtaacaaatgagaatgaaaaaaatatactattgtgaataaaaccccacacaacacattactataa  9259200
                                 ---------->DOF2                            <---------ANAC46
                          ----------->GT1                                   <---------ANAC58
                         --------->HSFB2a(2)                             <---------ARR14(2)
                       ----------->RAV1(2)                               --------->ARR11(2)
                       --------->ATERF1(1)                         <---------ALFIN1   ------->MYC3
                       ================================RAV        <---------KAN1      <-------MYC3
                       <------NtERF2       ----------->RAV1(1)    ----------->HVH21  <---------TGA1a
                      <---------RAP2.3(1) <----------ID1         <-----------HVH21   --------->TGA1a
------>AGL15          ------>NtERF2     --------->ANAC58      --------->ANAC58       ===============
-------AGL15        --------->RAP2.3(1) --------->ANAC58      --------->ANAC58       ===============
--------->GT1       --------->ATERF1(1)--------->DAG2       <------ZmHOX2a(1)     <---------ZAT18
---YAB1   <---------DOF5.7(1)    --------->DOF5.7(1)  <----------DOF2    <---------ARR11(2)
------->AGL3       <---------ATERF1(1)---------->DOF2 =========================================bZIP_DOF
--->YAB1 <----------DOF2 <---------HSFB2a(2)         <---------DEAR3(1)  --------->ARR14(2)      ---
taagttaaacttctttttttgtaggcgcctggaaaaaaaagaaaagcaacaagagggctgtgaggacgcatcaccggtttcgtagcacacatgtgcattt  9259300
                                   --------->AHL25(1)                                  --------->TOE2(3)
                                   <---------AHL12(1)                               <-----------GT1
                                  --------->AHL20(1)                             --------->YAB1
                                  <---------AHL20(1)                        --------->AHL12(2)
                                  --------->AHL25(3)                        --------->AHL12(3)
                                  --------->AHL25(1)                       <---------AHL20(1)
                                  <---------AHL12(1)                       --------->AHL20(1)
                                  <---------AHL25(1)                       <---------AHL25(3)
               <---------DOF5.7(1)<---------AHL20(2)                      <---------AHL12(1)
       <---------DOF5.7(1)        --------->AHL25(2)                      --------->AHL12(3)
      <---------DAG2              --------->AHL20(2)        --------->GATA12<---------AHL12(2)
      <----------DOF2             --------->AHL12(1)        <---------ARR11(3)  <---------AHL20(2)
     <---------ANAC58           --------->WOX13(2)          --------->GLK1(2)--------->AHL20(1)
     <---------ANAC58        <---------ATHB12               --------->ARR11(3)  <---------YAB1
 <----------DOF2            --------->RVE1(2)               <---------GATA12<---------AHL12(3)
<---------DOF5.7(1)<-----------GT1<---------AHL25(2)        --------->RVE1(2)<---------AHL20(1)-----
---------------ANAC81      --------->WOX13(1)          ----------->GT1    --------->AHL12(1)   <----
============bZIP_DOF <---------ANAC58                --------->DOF5.7(1)  --------->AHL25(1) <------
============bZIP_DOF <---------ANAC58         ------>ZmHOX2a(1)           <---------AHL12(3) -------
------->ID1   <---------MYB52(1)<---------WOX13(2)   ---------->DOF2      --------->AHL20(2)--------
gtctctttgctttttcggtttttttcttgccaatcaatttattttgttcctcagaaaaaagaaaatctaaaaccaaaatatatattataacctcatttaa  9259400
                                               <---------DOF5.7(1)                               ---
 ----------->RAV1(1)                           --------->TOE2(3)                 ---------->DOF2 <--
<----------ID1                         --------->ARR11(3)                      <---------YAB1   ----
---->WOX13(2)                          <-----------GT1                        <---------WOX13(2)----
-----WOX13(2)             ---------->DOF2      <---------MYB59            ----------->GT1       ----
---AHL20(2)   <-------GAMYB--------->DAG2   <---------WRKY18(1)           <------MYB46(1)       ----
-->AHL20(2)  --------->MYB52(2)   <---------AHL20(2)               ---------->DOF2<---------TOE2(3)
->AHL20(2)   <---------MYB46(3)  --------->AHL25(3)    <----------DOF2    <------MYB83       -------
taaacaacaaaaatgtttgttgaaaaaaaaaaagtttttatttatcttgaccttatttctttgaagaaaataaagcttggttattaaagaagtccaagtt  9259500
-------At4g35610            ---------->DOF2                                     <---------ALFIN1
-------WOX13(2)            <---------AHL25(1)                              --------->At4g35610
------>WOX13(2)            --------->AHL20(2)               --------->AHL20(2)------>MYB83
------>At4g35610         --------->WOX13(2)              <---------HSFB2a(2)  ------>MYB46(1)
-----GAMYB               <---------WOX13(2)              --------->HSFB2a(2)--------->DEAR3(1)
----->MYB52(2)       --------->At5g28300         <---------TOE2(3)       <---------ALFIN1    ------>MYB46(1)
----->MYB111(2)     ----------->GT1             ---------->DOF2      --------->AtMYB61       ------>MYB83
----->MYB46(2)      ------->GAMYB            <---------WOX13(2)     --------->MYB46(3)     *TSS ----
----->MYB111(1)  --------->MYB52(1)          --------->WOX13(2)   <-----------GT1         --------->ANAC46
----->MYB.PH3(2)<---------KAN1           ------>ZmHOX2a(1) ----------->TBP <---------At4g35610 -----
agttgccaccatcagtggcataacggtaaattaaagccaacttcctctaactaaagttttctataaattcaaccactcacctcccactctaaaacccaac  9259600
                                             --------->GATA12  ----------->GT1
                          <---------------AGL15                --------->ANAC46
           --------->RVE1(2)                 <---------GATA12  --------->ANAC58
           <---------ARR11(3)                <---------AGP1    --------->ANAC55(1)
           --------->ARR11(3)               <---------KAN1     <---------ANAC55(2)
          <---------KAN1  --------------->AGL15                --------->ANAC58
          <---------CCA1(2)                ----------->ARR10   --------->ANAC55(2)
      <-----------GT1    <-----------------AGL1------>ZmHOX2a(2)<---------MYB59
 <---------ICU4       <----------DOF2  <---------------------WRI1 --------->ARR11(2)
------->RAV1(1)   <----------DOF2  ---------->DOF2  --------->ANAC46    <----------DOF2
---->MYB46(3)    <---------DOF5.7(1) --------->DOF5.7(1)      <-------TEIL
aacataatttcacatatctctctttctttctcttgaaggaaagacgaagatctccaagtcccaagtacgtaactactttctccatctacattcaattgtt  9259700
                                       --------->WOX13(2)          --------->MYB111(2)
                                       <---------WOX13(2)     <-----------RAV1(2)
                                   --------->ANAC55(2)     ------->MYC3
                                   --------->ANAC46        ------->MYC2         <---------ANAC55(2)
                               <----------DOF2<---------AHL20(2)   <---------MYB46(3)<---------YAB5
    --------->WOX13(2)  <---------ANAC58     --------->AHL20(2)   <--------P    --------->ANAC58
    <---------WOX13(2)  <---------ANAC58   <---------RVE1(2)--------->ALFIN1    ----------->GT1
 ------>ZmHOX2a(1)    <-----------GT1<---------AHL20(2)    <-------MYC2         --------->ANAC58   <
--------->TOE2(3)     <---------AHL20(2)<---------WOX13(1) <-------MYC3  --------->ZAT6--------->TOE2(2)
tctccttaatttctctagtacatatttacttgtgctataagtaattgattttatatcacccatgtgcaggttgttaacacaagacgtaaacatgggtcat  9259800
                                                             <--------P     --------->ANAC58
                                                            <-------GAMYB   --------->ANAC55(1)
                                                          <---------ANAC58  <---------TGA1a
                                                          <---------DREB2C(2)     <----------DOF2
                                                          <---------ANAC46  --------->bZIP60(1)
                                                          <---------ANAC58  =================bZIP_DOF
                        <------ZmHOX2a(1)                 <---------DEAR3(1)--------->TGA1a   <-----
                       <------MYB83                      <------NtERF2      <---------bZIP60(1)
                       <------MYB46(1)                  ------------>AtMYB77--------->ANAC58<-------
                     <--------P                         ==============================MYC_MYB <-----
                  <---------TOE2(3)                     ------>NtERF2       --------->ANAC46--------
               <---------YAB1                          --------->ALFIN1     --------->O2   ---------
               --------->ICU4                          <---------DEAR3(1)   <---------O2   <--------
             --------->YAB5                      --------->ARR11(2)    ===============MYC_MYB ------
             --------->YAB1                      --------->ARR14(2)    ------->GAMYB       <--------
            <---------YAB5                    <---------RAP2.6(2) <------ZmHOX2a(2)    <---------At5g28300
            --------->ICU4                   <---------At4g35610 --------->GATA12 <---------DAG2
            <---------YAB1       <---------ANAC58<---------ARR11(2)<---------WRKY38(1)<-----------GT1
        --------->WOX13(2) <---------YAB5<-----------HVH21<---------RAP2.6(2)  <---------ALFIN1<----
        <---------WOX13(2)<-----------HVH21  --------->At4g35610 <---------GATA12 <---------DOF5.7(1)
---------TOE1(2)  <---------YAB1 <---------ANAC58<---------ARR14(2)<---------WRKY12<---------DOF5.7(1)
cttgggttcttagttatgattatggtaggagtcatggcttcttctgtgagcggctacggtggcggttggatcaacgctcacgccactttttacggtggtg  9259900
  <---------ANAC58                                                                                 <
<---------YAB1                     <---------MYB59           <---------ICU4                        <
----ANAC46                        --------->ANAC55(2)     --------->YAB1                           <
--MYB46(3)                      <-----------GT1          <---------YAB1                       <-----
----AtMYB61                   <---------WOX13(2)         <---------YAB5                       ------
->MYB55(2)                   --------->MYB52(2)       <---------AHL12(1)                    <------MYB83
>ALFIN1--------->LBD16     <---------MYB52(1)  ------>ZmHOX2a(1)                            <------MYB46(1)
-DEAR3(1)                ----------->GT1      <---------ANAC58                             <--------
--->ALFIN1            ------------>MYB.PH3(1) <---------ANAC58  <-----------GT1            ---------
-AtMYB61             --------->DOF5.7(1) --------->KAN1--------->YAB1                 <----------DOF2
-----MYB46(3)   ----------->GT1 <---------AHL20(2)   <---------AHL12(2)         <-----------GT1   <-
gtgatgcttccggcacaatgggtaaaaaccgttatttacataactcattccttacaaattatcatatttactaatcttcaatgttacttctttgtaggtg  9260000
       --------->CCA1(2)                       <---------RAP2.3(3)
      --------->ARR11(2)                       <---------RAP2.6(2)
      <---------RVE1(2)                        <---------DEAR3(1)
      --------->ARR14(2)                       <---------RAP2.3(2)                              <---
      <---------ARR11(2)                      --------->RAP2.6(3)                               <---
      <---------ARR14(2)                     <---------ATERF1(1)                            <-------
   <---------ANAC46                         --------->ANAC58                                <-------
---------ANAC46                             --------->ANAC58                            <---------MYB46(3)
---------ANAC58                             <---------DEAR3(1)                         <---------AtMYB61
---------ANAC58                             --------->ANAC46                           --------->ALFIN1
----DEAR3(1)                             --------->ZAT2      <---------At4g35610   <---------At4g35610
--->ALFIN1                         ----------->HVH21         <---------ZAT2        --------->At4g35610
-AtMYB61                         <---------ANAC55(2)         --------->At4g35610   <---------ZAT2
>MYB111(1)----------->GT1        --------->ANAC55(2)         --------->ZAT2        --------->ZAT2<--
--------MYB46(3)                <---------LBD16<---------RRTF1(3)             ------->TEIL<---------ARR14(2)
gtgcttgtggatatggtaatctatatagccaaggctacgggacgagcacggcggctctaagcacagctctcttcaacaatggacttagctgtggttcttg  9260100
<- Previous    Next ->

AGI:  At1g26770.1   
Description:  ATEXPA10 (ARABIDOPSIS THALIANA EXPANSIN A10). Identical to Expansin-A10 precursor (EXPA10) [Arabidopsis Thaliana] (GB:Q9LDR9); similar to ATEXPA1 (ARABIDOPSIS THALIANA EXPANSIN A1) [Arabidopsis thaliana] (TAIR:AT1G69530.2); similar to ATEXPA1 (ARABIDOPSIS THALIANA EXPANSIN A1) [Arabidopsis thaliana] (TAIR:AT1G69530.1); similar to expansin [Pyrus pyrifolia] (GB:ABR04073.1); contains InterPro domain Expansin 45, endoglucanase-like (InterPro:IPR007112); contains InterPro domain Rare lipoprotein A (InterPro:IPR005132); contains InterPro domain Expansin/Lol pI; (InterPro:IPR007118); contains InterPro domain Expansin; (InterPro:IPR002963); contain
Range:  from: 9259592    to: 9261300    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.