Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
              <---------ZAT18                     --------->ZAT14        <---------ARR11(2)      <--
              --------->ZAT18                <---------------AGL15       --------->ARR11(2)     ----
-----RVE1(2) <---------ANAC46                --------------->AGL15     <---------MYB46(3)      <----
-----GATA12  <---------ANAC58             <---------AHL20(2)          <---------YAB5          <-----
---->GATA12  <---------ANAC58      ---------->ID1 <---------ZAT14 <---------YAB1             ------>ZmHOX2a(1)
tttgagttataaacttgtgtgctactagtaaaccacttgttgtattttcttagtatagtaaaaacaattctgaatggttccacatagacaagagtcctct  7193900
                         <-----------GT1--------->LBD16 <-------TEIL              --------->MYB52(2)
                   --------->DOF5.7(1) --------->ANAC55(2)                      <--------P
                   --------->DAG2   ------->TEIL       --------->CCA1(2)       <-------GAMYB
         --------->WOX13(1)    <---------AtLEC2--------->AHL20(2)             --------->MYB55(2)
   ------>ZmHOX2a(1)----------->GT1 <---------ARR14(2)<---------RVE1(2)       <---------MYB46(3)
---------GT1     ---------->DOF2    <---------ARR11(2)<---------ARR11(2)    <---------MYB52(1)
----->ZAT14 --------->YAB1    <-------TEIL ---------->DOF2         --------->ANAC58
------DOF2 <---------ATHB12  --------->AtLEC2----------->GT1       --------->ANAC58
----DOF5.7(1) --------->At4g35610   --------->ARR11(2)--------->ARR11(2)  <-----------RAV1(1)<------ZmHOX2a(1)
ttactccttactcaatcagcaaaaggttttacatgcatgaatccgtaaaagtaaatagatacacatagacacggcttctggtggttagtgaatggaggag  7194000
                                        ----------------->AGL1                                  ----
                                        <-----------------AGL1                                ------
                                        <-----------------AGL3                                ------
            ----------->HVH21         --------->RVE1(2)    <---------ARR11(3)                 <-----
      <---------YAB1               --------->YAB1 <---------RVE1(2)                <-----------RAV1(1)
<---------KAN1             ---------->DOF2  --------->ARR14(2)               <---------KAN1  -------
agagtatgtatgatggtgacagaaaacagcaaaagctataatatccaaatttggataaagaagctcttaaacgcgttggaatacttatgttggaagaagc  7194100
    ---------->DOF2             --------->At4g35610
 --------->ANAC46       --------->At5g28300
 --------->ANAC58      ----------->GT1
 --------->AtLEC2    --------->ZAT14
 --------->ANAC58    <---------ZAT14                           --------->REM1(1)
------->HVH21        --------->ZAT18                        <---------ARR11(2)        ----------->RAV1(1)
--->At4g35610      <---------ZAT14                    --------->ALFIN1               <---------KAN1
--->ZAT2   --------->DOF5.7(1)--------->YAB1--------->YAB1 <-------GAMYB  --------->YAB1
----At4g35610      --------->ZAT14     <---------------------WRI1       --------->RVE1(2)
-->GLK1(2) ---------->DOF2   <---------YAB5----------->TBP----------->GT1 --------->YAB5
tgacaagcaaaggaaaaagcagagcacagtgaatcatctctcggctataaaaacagagagggggttacaactcaaaatcacaacaagaacaacacagagc  7194200
                                                 ------>ZmHOX2a(2)                                 <
                                               <---------ARR14(2)                             ------
                                               <---------ARR11(2)                             <-----
                                               --------->ARR11(2)                          <--------
        --------->RVE1(2)                      --------->ARR14(2)                          ---------
   ------------>CBF                            --------->GATA12                            ---------
   <-------TEIL                     --------->ANAC58      ------------>CBF                 <--------
  --------->GLK1(2)        <---------GLK1(2)   <---------GATA12                     ----------->TGA1
 <---------GATA12 <----------DOF2   --------->ANAC58<---------TOE1(2)  ----------->GT1  <---------At4g35610
aagagattcaatagcaaaaaacttttacaaaattctctcaagaaaatggggatcgtagcattccaatggggagagggagaaaacatactgacgctgctgc  7194300
----At4g35610   <---------ATHB12
-ZAT2          --------->ANAC58                       <---------YAB1              ------->TEIL
>At4g35610     --------->ANAC58                 --------->MYB59      <---------RVE1(2)
>ZAT2 <---------ZAT14   ----------->GT1         <---------TOE2(3)<---------At4g35610
-At4g35610    --------->WOX13(1)                <---------TOE1(3)--------->At4g35610
agaacagagagaactggcaatcaaggcaagtttaaaattctttcgacgttttaggttataatttgtgcatcagacattgttgatgaacctgtattttgta  7194400
                           <---------ANAC58                                                ---------
                           <---------ANAC58                                              <---------ARR11(2)
                           <---------ANAC46                                              <---------MYB52(1)
                          <---------ZAT2                                               <---------MYB46(3)
                          <------NtERF2                             --------->LBD16   --------->ALFIN1
                         <---------RAP2.3(1)                   <-------GAMYB         ------->PIF5
                         ------>NtERF2                         ===============================MYC_MYB
                        <---------RAP2.6(2)                   <---------MYB46(3)     <-------PIF5
                        <---------DEAR3(1)                 <---------MYB46(3)       --------->TGA1a
                        <---------RAP2.3(2)               --------->ALFIN1          <---------ANAC46
                       --------->RAP2.6(3)              <---------ANAC58            ================
                     --------->DOF5.7(1)                <---------ANAC46            <---------ANAC58
                    ---------->DOF2                     <---------ANAC58            <---------bZIP60(2)
         ----------->GT1<---------RAP2.3(3)            --------->ATHB12             <---------ANAC58
   <---------WOX13(1)--------->DAG2            <-----------RAV1(2) <---------ANAC46 --------->O2
   <---------YAB1   --------->DOF5.7(1)     --------->ANAC58  <---------DEAR3(1)    <---------O2
 ----------->GT1   ---------->DOF2          --------->ANAC58  --------->MYB52(2)    <---------TGA1a
 --------->YAB5   <------ZmHOX2a(1)       ---------->DOF2 <---------AtMYB61      ----------->HVH21
tgggtgattaataggtcaataggaaaggcggcttgggaatgggatgaaagccaggtattgagtggtcgttgcgcagagaccgatgggacgtggttaggta  7194500
                      <---------ANAC58                        --------->ATERF1(1)
->ANAC55(2)       <---------DOF5.7(1)    --------->DOF5.7(2) <---------RAP2.3(1)
--ANAC55(2)       <---------DAG2  --------->ATERF1(1)        <---------ATERF1(1)
>MYB59  ------>NtERF2 <---------ANAC58   <---------MYB52(1) <---------DEAR3(1)    --------->ATHB12
>MYB111(1)        <----------DOF2 <------NtERF2          --------->YAB1  <---------ANAC58       <---
>MYB46(2)        <---------DOF5.7(1)--------->PCF2       --------->ATHB12<---------ANAC58   <-------
>MYB52(2)  <------NtERF2       <------NtERF2            <---------KAN1--------->ALFIN1    ----------
=============================bZIP_DOF   <-------GAMYB   <---------YAB5<---------KAN1   --------->TOE2(3)
tttctattcgaggccgagtcgcttttcttgtggaggcagggcccgttaacagagacagaatcatcggcgccgagtgtcgtactcttgatttcttaaaggt  7194600
     --------->ATHB12                             --------->LBD16                                  <
     <---------ICU4                              <---------ANAC55(2)                               <
    <---------YAB1                               --------->ANAC55(2)                             ---
    <---------ATHB12                             --------->ANAC46                                <--
    --------->ICU4                        <---------GLK1(2)                                      ---
    <---------YAB5                        --------->ARR14(2)                                     ---
   <---------TOE2(3)                      <---------RVE1(2)                                      <--
  --------->YAB1                <-----------GT1 <---------LBD16                           <---------
----TEIL              --------->AHL12(1)  <---------ARR11(2)                           <------ZmHOX2a(1)
--TOE2(3)  <----------DOF2 ----------->GT1<---------ARR14(2)                          <---------ZAT18
>DOF2--------->YAB5 <---------RVE1(2)     --------->ARR11(2) --------->YAB5      <---------ZAT14 <--
tcgattaatgatttctttttgttgattttttggttaaactatctggattctcacgggattgcgttgattacagagcaacttgagtccagaggactttgca  7194700
            <---------GLK1(2)    --------->GLK1(1)
            <---------GATA12     <---------GLK1(1)
       <----------DOF2          --------->ARR14(2)      ------>NtERF2
      <---------ANAC58    <---------LBD16               ----------->RAV1(1)
--------->ATHB12    --------->ANAC46                    <---------DDF1
---------YAB5      --------->SPL7(1)                   --------->RAP2.6(2)
-------TEIL --------->GATA12--------->LBD16      <-----------RAV1(1)
------>GATA12    --------->LBD16<---------ARR11(2)     --------->DREB2C(2)
-------ARR14(2)  <---------SPL7(1)             --------->WOX13(2)                                <--
------>ARR11(2) <---------HSFB2a(2)            <---------WOX13(2)                               <---
------>ARR14(2) --------->HSFB2a(2)      --------->YAB1----------->HVH21           --------->ARR11(3)
-------ARR11(2)<---------LBD16  --------->ARR11(2)     <---------ETT(1)            <---------ARR11(3)
-DOF2 <---------ANAC58----------->HVH21 <---------ATHB12<---------RAP2.6(3)        --------->RVE1(2)
-------GATA12--------->GLK1(2)  <---------ARR14(2) <---------RAP2.6(2)            <---------CCA1(2)
gattcattggctttagattccggacgtaacacggggatagcctatcatctaattgtggccgacatagtttcaaactcaatgttttatatctacaaaccgt  7194800
<- Previous    Next ->

AGI:  At1g20730.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G20740.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN74747.1); contains InterPro domain F-box associated type 1 (InterPro:IPR006527); contains InterPro domain Protein of unknown function DUF833 (InterPro:IPR008551)
Range:  from: 7194266    to: 7198671    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.