Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                         <---------ANAC58
                                                         <---------ANAC58
                                                         <---------ANAC46
                                                        <---------LBD16
                                ---------->DOF2      <---------ANAC58                 ------>ZmHOX2a(1)
                           ------>ZmHOX2a(1)         <---------ANAC58      --------->ATHB51
                          <---------LBD16        <---------ANAC58          --------->ATHB12
                    <---------AHL12(2)           <---------ANAC58         <---------AHL20(3)
                    --------->AHL12(2)        <-------PIF5                <---------AHL20(2)
                 <---------CCA1(2)            ------->PIF5             <---------RVE1(2)
--DOF2 <---------ZAT18 <-----------GT1 --------->WRKY38(1)--------->LBD16 <---------YAB1
 
gtagaactagtggtcttcttgtatattttcctggctaaagaattgaccacgagcttgtttgcgggtctcaaactgatattattggtctcctccaaggagg  6471400
                                                                                  <----------ID1
                                                                                  ----------->GT1
                                                                             <---------ICU4
                                                                             --------->YAB5
                                                                             --------->ATHB12
                                                                             <--------HAHB4
                                         <---------DOF5.7(1)                --------->ICU4
                                    --------->GATA12                        <---------YAB1
                                    --------->ARR14(2)                      <---------YAB5
                            --------->ZAT14                               <-----------------AG
                       <---------DOF5.7(1)                                <-----------------AGL1
                      ------>ZmHOX2a(1) ====================================HOX2a_HOX2a          <--
             <---------WOX13(2)     <---------ARR14(2)                   <-------TEIL      ---------
             --------->WOX13(2)--------->ANAC46                       <---------DEAR3(2)   ---------
  --------->MYB46(3)------>ZmHOX2a(2)   ------>ZmHOX2a(1)            ===============================
--------->ARR14(2)  ===========================HOX2a_HOX2a           ------>ZmHOX2a(2)     ---------
--------->ARR11(2)<---------RVE1(2) --------->ARR11(2)             --------->GATA12<------ZmHOX2a(1)
<---------ARR11(2)--------->GATA12  <---------GATA12   --------->KAN1=====================HOX2a_HOX2a
 
ctcgaaccgcttcttcaatttgatcctcttcttcactcaaatcctcttcttcaatctcatactcttcttcgatcggttcatcattaggaaaaataagcaa  6471500
                  --------->LBD16
                 --------->LBD16
   --------->ANAC46                                                                    --------->ANAC58
   --------->ANAC58                             <---------At5g28300                    --------->ANAC58
   --------->ANAC58                   --------->LBD16                 --------->At4g35610
----ZmHOX2a(1)  <---------LBD16      <---------ANAC58             <---------WOX13(2)  --------->SPL7(1)
>ANAC58         --------->LBD16      <---------ANAC58        ----------->GT1      --------------->AtSPL8
>ANAC58  <---------ATHB12            <---------ANAC46   ----------->RAV1(1)   --------->RVE1(2)   --
====HOX2a_HOX2a<---------LBD16      <---------LBD16  ----------->RAV1(1)     <---------KAN1      <--
>ANAC46 <-----------ARR10   <-----------GT1 --------->MYB52(2)    --------->WOX13(2)<---------SPL7(1)
 
ggacacaagcaaatcatcccccggagaatagtcacctcttgcgggattagttactgcaacaacatagaaaattagctcaaatatcgcagtaccccattcc  6471600
                                                    <------MYB46(1)
                                                    <---------ANAC58
                                                    <---------ANAC58
           <---------WOX13(2)         ----------->GT1
           --------->WOX13(2)        <---------TOE2(3)<---------ANAC46
        <---------MYB52(1)         --------->ICU4   <------MYB83 <---------WOX13(1)
        --------->DOF5.7(2)   --------->ANAC58      <---------ANAC46
       --------->TOE2(3)      --------->ANAC46     <---------AtMYB61
      ----------->GT1         --------->ANAC58     --------->MYB46(2)
     --------->ICU4       ------>ZmHOX2a(1)        --------->MYB111(2)              --------->GLK1(1)
     <---------YAB5   --------->ARR11(2)           --------->MYB111(1)              <---------GLK1(1)
--------->YAB1        <---------ARR14(2)           --------->MYB55(2)             <------ZmHOX2a(1)
------->RVE1(2)       <---------ARR11(2)           <---------MYB46(3)    --------------->AGL15
-------CCA1(2)        --------->ARR14(2)   --------->ICU4      --------->ATHB12 <---------TOE2(3)
 
atatcgtaatcgttaattagctctgaatcctccaagaaataatgtaatttttgtttggtgggaaactgattgttttcttcgttgaggaattcttcgataa  6471700
                                                                                     <---------RVE1(2)
                                                                                     --------->ARR11(3)
                                                                                     <---------ARR11(3)
                                                                                    --------->YAB1
                                                                                   <---------YAB1
                                                                               <---------ANAC55(1)
                                                                               <---------ANAC58
                                                                               <---------ANAC55(2)
                             <---------ETT(2)                                  <---------ANAC46
                          ------->GAMYB                                     <---------WOX13(1)
                         --------->DEAR3(2)                               <---------ICU4
                         --------->MYB46(3)                               --------->ATHB12
                         <------------AtMYB77                             --------->YAB5
                       <---------ARR11(2)                                --------->ICU4
                       --------->ARR11(2)                     <----------DOF2  --------->ANAC55(2)
                       <---------ARR14(2)                 <------NtERF2  <---------YAB1
                       --------->ARR14(2)                ------>NtERF2   <---------YAB5
                   <---------YAB5                   --------->ZAT18   <---------MYB46(3)
                   <---------ZAT6                  <---------KAN1    <--------P<---------ANAC58
   ------->TEIL--------->ZAT14 <---------RVE1(2)   --------->ALFIN1  <---------WOX13(1)    <--------
 
acgatgtatcagtaaatgtgtagtcgtaaccgtcgatatttgcattcactgagagtgtgccagcgttttctggttgatgattgcgtatgatattgtggta  6471800
                                             --------->AHL25(1)
                                             <---------AHL25(3)
                                             <---------AHL25(2)
                                             <---------AHL20(3)
                                             --------->AHL25(3)
                                             <---------AHL12(3)
                 <---------WOX13(1)          <---------AHL20(2)
                <------------CBF             --------->AHL20(3)
               --------->ATHB12              --------->AHL20(2)                                  <--
             <---------WOX13(1)              <---------AHL25(1)                           <---------
           <---------ICU4            <---------YAB1                                      <---------TOE2(3)
           --------->ATHB12          ----------->GT1                                 <----------DOF2
          --------->ICU4           --------->YAB5                                   <---------ANAC58
          <---------YAB1    --------->DOF5.7(1)          --------->YAB1             <---------ANAC46
          <---------YAB5  ---------->DOF2    --------->AHL25(2)                     <---------ANAC58
-TOE2(3)--------->YAB1    --------->DOF5.7(1)--------->AHL20(1)          <---------KAN1<---------ARR11(2)
 
gaaatctattctcatgattgattgaagaaaaaagaagatgatgaaaaataaaataagaaatcaaaatgttgatggaatttgtgtctggcgtttatgttgt  6471900
                                                                   --------->AHL25(2)
                                                                   <---------AHL20(2)
                                                                   <---------AHL20(3)
                                                                   <---------AHL25(2)
                                 --------->AHL20(2)              <---------YAB1
                                 <---------AHL25(2)             --------->AHL12(2)
                                 <---------AHL20(2)             <---------AHL12(2)
                                 --------->AHL25(3)            <---------AHL20(2)
                                 <---------AHL20(1)           --------->AHL20(2)
                                 --------->AHL25(2)           --------->ICU4
                                 --------->AHL25(1)  <------NtERF2--------->AHL12(1)
                    --------->GLK1(2)               <---------DEAR3(2)
                   <---------GLK1(2)  <---------AHL25(1)      --------->AHL25(3)
                   <---------ARR14(2) <---------AHL20(3)     --------->AHL12(2)
                   --------->ARR14(2) --------->AHL20(3)     --------->AHL12(3)
           <---------AHL20(2)    <---------AHL25(1)<---------DEAR3(1)
      <---------MYB52(1)         --------->AHL20(3)--------->ETT(1)--------->AHL20(3)      <--------
     --------->TOE2(3)        ------->TEIL        --------->ATERF1(1)                     <---------GLK1(1)
    ----------->GT1<---------ARR11(2) <---------AHL20(2)  <---------ARR11(3)   --------->AHL20(2)
---------HVH21    <------ZmHOX2a(1) --------->AHL12(2) ----------->RAV1(1)     <---------AHL20(2)
--RAV1(1)<-----------TBP <---------AtLEC2         --------->RAP2.6(3) <-----------GT1 <---------HSFB2a(2)
 
tgtcacaacgttatttatagaggattctgcatgcattttatttttttgatggggtcggcaacatatttattattttccatttttaaatactagaaatctg  6472000
                          <---------MYB46(2)
                    <-----------GT1
                    <---------YAB1
                 <---------YAB1
                 <---------YAB5
                --------->AHL12(2)
                <---------AHL12(2)
                --------->AHL20(3)
                <---------AHL20(3)
                <---------AHL12(3)
                --------->AHL25(2)
               --------->YAB1
               <---------ICU4
               <---------AHL25(3)
              --------->AHL20(2)
              <---------AHL20(2)
              --------->AHL25(1)
              <---------AHL25(1)
              --------->AHL12(3)
              --------->AHL25(3)
              <---------AHL12(3)
              <---------ATHB51
              --------->ICU4
              <---------AHL12(1)
              --------->AHL12(1)
            <---------AHL12(2)
            --------->AHL12(2)
           <---------AHL20(2)
           <---------AHL25(3)
          --------->AHL20(2)
          <---------AHL20(3)
          <---------AHL20(2)
          --------->AHL12(3)
          --------->AHL25(1)
          <---------AHL12(3)
          --------->AHL20(3)
          <---------AHL25(3)
          --------->AHL12(1)                                                     --------->DOF5.7(1)
          <---------AHL25(1)                                                     --------->DAG2
          <---------AHL12(1)                                                    --------->DAG2
          --------->AHL25(3)--------->MYB52(1)                                 --------->DOF5.7(1)
        --------->WOX13(2)<---------MYB111(1)                              --------->LBD16
      --------->AHL20(2)  --------->MYB46(3)                              ----------->GT1
      <---------AHL20(2) --------->WOX13(2)                   <---------MYB46(3)--------->DOF5.7(1)
   <----------DOF2--------->YAB1                            <------------CBF   ---------->DOF2
<-----------GT1--------->YAB5  ------->GAMYB             ------------>CBF<---------LBD16
-GATA12 <---------WOX13(2)<---------MYB52(2)     ----------->HVH21 ----------------->AGL1
 
atttaacttttaattaaataattatactaactaacggcgttactacgcttgtttgacacatacaattgttgacaaaaccggaaaaaggtgttttgcatcg  6472100
                           --------->REM1(1)
                          <------NtERF2
                         ------>NtERF2
                         ----------->RAV1(1)
                       <------NtERF2
                      ------>NtERF2--------->ANAC58
                      --------->LBD16
                      <---------ATERF1(1)
                     <---------DEAR3(1)
                     --------->LBD16                                                           <----
                    <---------LBD16--------->ANAC46      <---------O2                          <----
               --------->DOF5.7(1) --------->ANAC58 ------>ZmHOX2a(2)                        <------
             --------->DOF5.7(1) <---------ALFIN1 --------->ARR11(3)                       ---------
             ---------->DOF2  --------->ANAC46    <---------ARR11(3)                --------->KAN1
        ----------->GT1--------->RAP2.3(1)        <---------RVE1(2)          <-----------RAV1(2)
        --------->ANAC58<---------ETT(2)       <---------WOX13(1)       --------->ANAC58  <---------YAB5
        --------->ANAC58--------->DEAR3(1)    <---------WOX13(2)        --------->ANAC46  <---------YAB1
      --------->MYB52(1)----------->HVH21    --------->ATHB12           --------->ANAC58--------->YAB1
 
gcaaatacaaaacggaaaaagaccccggcgacaacaccacgcactagttcattgatcttcacatggcaacttgaaacgacacaggggacaatcgtgattg  6472200
                                                                           --------->RVE1(2)
                                                                         <---------AHL12(1)
                                                                         <---------AHL20(1)
                                                                         --------->AHL20(1)
                                                                         --------->AHL25(2)
                                                                         --------->ARR11(3)
                                                                         <---------AHL25(3)
                                                                         <---------ARR11(3)
                                                                         --------->AHL12(1)
                                                                        --------->AHL20(2)
                                                                        <---------AHL25(1)
                                                                        --------->AHL12(3)
                                                                        <---------AHL12(3)
                                                                      <---------AHL12(3)
                                                                      --------->AHL20(3)
                                                                    <---------YAB1
                         --------->TOE2(3)                        ----------->GT1
                       <---------YAB5                             --------->YAB5
    <-----------------AGL1                       <-----------GT1  --------->YAB1
    ----------------->AGL1  ---------->DOF2  --------->AHL20(2)  ----------->GT1       <---------TOE1(3)
--MYB83              --------->YAB1          <---------ARR11(3)  <---------YAB5        <---------TOE2(3)
--MYB46(1)          <-------TEIL             --------->AHL20(1)  <---------YAB1    --------->TOE2(3)
---WOX13(1)      --------->KAN1       <---------ETT(2)         --------->YAB1    <---------ARR11(3)
>ATHB12      <------ZmHOX2a(1)       ---------->ARF1  ----------->GT1 <---------AHL20(3)     <------
 
gtctcaaaccagtttaggacacattcatcgtcaaagtcatgtctaccatatattacgacgttacaagaatgataaatatatcaatatgttaatgttttta  6472300
<- Previous    Next ->

AGI:  At1g18760.1   
Description:  zinc finger (C3HC4-type RING finger) family protein. similar to zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] (TAIR:AT3G13228.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN74950.1); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Ubiquitin interacting motif (InterPro:IPR003903); contains InterPro domain Zinc finger, RING-type; (InterPro:IPR001841)
Range:  from: 6471141    to: 6471815    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.