Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
     --------->GLK1(2)
    --------->ARR14(2)                   ------>MYB46(1)
    <---------GATA12             <---------O2
    <---------GLK1(2)            --------->O2
    <---------ARR14(2)     <------ZmHOX2a(2)
   --------->KAN1         --------->GATA12        --------->AtLEC2
  --------------->ANT     <---------GATA12        ----------->GT1
--------->SPL7(1)         --------->AGP1 ------>MYB83                                        -------
---------SPL1(1)          --------->ARR11(2) --------->ANAC58                            --------->YAB1
-------->SPL1(1)          <---------ARR11(2) --------->ANAC46                <---------GLK1(2)
--------SPL1(2)           <---------ARR14(2) --------->ANAC55(1)             <---------RVE1(2)
--------SPL7(1)           --------->ARR14(2) --------->ANAC58    --------->DOF5.7(1)  --------->GLK1(1)
------------>SPL14  <---------GLK1(1)  <---------MYB59         ---------->DOF2--------->GLK1(2)  ---
-DOF5.7(1)          --------->GLK1(1)  --------->AtMYB61  ----------->GT1   --------->KAN1 ---------
 
ccgtacagattccgatgttagagaaatcagatcgagacgagaccaaacacgaaatgcaaaatggctaaaagagagagagagattctgagaaatcaaaaga  4891800
                     --------->YAB1
                     ----------->GT1
                   <---------WOX13(1)
                 --------->ATHB12
            --------->ARR14(2)                                  --------->WOX13(2)
            <---------ARR14(2)                                  <---------WOX13(2)
            --------->GATA12            <----------ID1         --------->ATHB12
            <---------GATA12            ----------->GT1       <---------YAB1                     <--
        ------>ZmHOX2a(2) --------->DOF5.7(1)                <----------DOF2                     ---
      <---------GATA12   <---------AHL20(3)                 <---------DOF5.7(1)                <----
-->DOF5.7(1)--------->RVE1(2)   <---------ARR11(2)       ---------->ID1       ------->GAMYB  <------MYB83
------>YAB5<---------CCA1(2)    --------->ARR11(2) <---------AHL12(1)      --------->WOX13(1)<------MYB46(1)
->DOF2--------->RVE1(2)  --------->AHL20(3)        --------->AHL12(1)   --------->TOE2(3)   --------
 
cgattagatgatccaaatctcgattgataaaaatggattcagaaggaaaaacaaaaatttgtctctttattgaaacatcaatcgccaaaacaaatttggt  4891900
              <----------DOF2
             ------>ZmHOX2a(2)
            <------ZmHOX2a(2)
            <---------RVE1(1)
           <---------RVE1(2)
           <---------ARR14(2)
           <---------GATA12
           <---------ARR11(3)
           --------->ARR11(3)
           --------->ARR14(2)                                               ------>ZmHOX2a(2)
           --------->GATA12                                                --------->At4g35610
           --------->AGP1                                                  <---------At4g35610  ----
           <---------AGP1                                                 <---------RVE1(2)    <----
          <---------CCA1(2)                                               --------->GATA12    <-----
          <---------At4g35610                                             <---------GATA12    ------
   ---------->DOF2                                                  <---------YAB5            <-----
-------At4g35610   --------->GATA12           --------->DOF5.7(1)   <---------KAN1  --------->YAB5
------>At4g35610   <---------GATA12           ---------->DOF2--------->DOF5.7(1)   <---------YAB1
----P <-----------HVH21                ------------------------>ANAC81   --------->ZAT14  <---------
->MYB59  ----------->ARR10       <---------LBD16         --------->LBD16 <---------ZAT14------------
 
agcttcaaaagtcagatctttagattccaaatttgactcggaaaacaaaaaaagaaaacccagaaaaacgaatcactgatctgaatatgattcctttagc  4892000
                                                                    --------->YAB1
                                                                  --------->AHL25(2)
                                                                  <---------AHL20(3)
                                                                  <---------AHL12(2)
                                                                 --------->YAB1
                                                                 <---------ICU4
                                                                --------->ICU4
                                                               --------->AHL25(2)
                                                               <---------AHL12(3)
                                                               <---------AHL12(2)
                                                               <---------AHL25(2)
                                                               <---------AHL20(3)
                                                              <---------ICU4
                                                              --------->YAB1
                                                             <---------YAB1
                                                             --------->ICU4
                                                            --------->AHL25(2)
                                                            <---------AHL20(3)
                                                            <---------AHL12(2)
                                                            <---------AHL25(2)
                                                            --------->AHL20(3)
                                                            <---------AHL12(3)
                                                           <---------ICU4
                                                           --------->YAB1
                                                          <---------YAB1
                                                          --------->ICU4
                                                         --------->AHL25(2)
                                                         <---------AHL20(3)
                                                         <---------AHL12(2)
                                                         <---------AHL25(2)
                                                         --------->AHL20(3)
                                                         <---------AHL12(3)
                                                        <---------ICU4
                                                        --------->YAB1
                                                       <---------YAB1
                                                       --------->ICU4
                                                      --------->AHL25(2)
                                                      <---------AHL20(3)
                                                      <---------AHL12(2)
                                                      <---------AHL25(2)
                                                      --------->AHL20(3)
                                                      <---------AHL12(3)                      <-----
                                   --------->ANAC58  <---------ICU4 <---------ICU4           <------
                            <----------DOF2          --------->YAB1<---------YAB1            -------
                           --------->YAB5           <---------YAB1<---------AHL25(2)         <------
                         <---------ARR14(2)         --------->ICU4--------->AHL20(3)         -------
   >>>>>>>>>TBF1         --------->ARR14(2)        --------->AHL25(2)                        <------
----->LBD16              <---------ARR11(3)        --------->AHL20(3)                        <------
-----ANAC46              --------->ARR11(3)       --------->YAB1<---------YAB1  ---------->DOF2
----LBD16<------ZmHOX2a(1)<---------KAN1         <---------AHL20(2)--------->ICU4            -------
--->At4g35610            --------->GLK1(2)      --------->AHL20(2)<---------AHL12(3)      --------->ANAC55(2)
----At4g35610           <---------GLK1(2)    --------->AHL20(2)--------->AHL20(3)        <---------LBD16
-DOF2 <---------------------WRI1   --------->ANAC58<---------AHL20(3)        >>>>>>>>>TBF1<---------ANAC55(2)
----->AGL1    <<<<<<<<<<<<<<<<<LFY --------->ANAC46<---------AHL25(2)  --------->YAB1   --------->MYB52(1)
 
ggagaagaagaaggagagaacaatggagaatctttaacaaggaagagattatataataataataataataataataagaagaagaaagtacttacggatt  4892100
                                           --------->AHL25(3)
                                          --------->AHL12(2)
                                          <---------AHL12(3)
      ---------->DOF2                     <---------AHL12(2)
   <---------TOE2(3)                      --------->AHL12(3)
  --------->MYB52(1)                     --------->AHL12(2)
----KAN1--------->DOF5.7(1)             --------->AHL12(1)  <-------GAMYB
---GATA12                               <---------KAN1     <---------MYB46(3) --------->ARR11(2)
-->GATA12                           <---------TOE2(3)      <---------DEAR3(2) --------->ARR14(2)
---ARR14(2)              ---------->DOF2<---------AHL12(1) <-----------RAV1(1)--------->GLK1(2)
-->ARR14(2)              --------->DOF5.7(1)      <---------WOX13(2)          <---------ARR14(2)
---ARR11(2)    <----------ID1  --------->YAB5     --------->WOX13(2)          <---------ARR11(2)----
---RVE1(2)   ------------------------>ANAC81<---------AHL20(2)   --------->ARR11(2)   ----------->HVH21
-->ARR11(2) ---------->DOF2--------->DOF5.7(1)  <---------AHL20(2)            <---------GATA12  <---
 
tggattaacgaaagagaaagaacaaaaaaaaagaagattaagaatatttattcaattgtggtctgttggaaactctctgcgaatcggaagtgaagcgtaa  4892200
                ----------->GT1
         <---------GATA12
         --------->GATA12                                                         <---------DOF5.7(1)
     ------>ZmHOX2a(1)                                                --------->KAN1
 <---------ARR14(2)                                                  <---------AHL20(2)   <---------ANAC58
 --------->ARR14(2)                                               <------------------------ANAC81
 --------->ARR11(2)                                            ------>ZmHOX2a(1) <----------DOF2  --
 <---------ARR11(2)  <-----------GT1                       XXXXXXXXXXXXXXXXXXXXX>MIR4221<-----------GT1
----->ICU4    ---------->DOF2                *TSS         <----------DOF2       <---------DOF5.7(1)
------YAB5  ----------->HVH21 <---------AtLEC2           <---------DOF5.7(1)<<<<<<<<<TBF1 <---------ANAC58
 
tgagtttcctcaggtctgaaagttaaactctttggatgtcgaattcaacttctctctctctctttcctctgttttattcttcttcttttttttacttggg  4892300
                              --------->YAB1
                              -------->HAHB4
                              <---------ICU4
                        ----------->GT1
                    <---------AHL12(2)
                    <---------WOX13(2)
                    --------->WOX13(2)
                   --------->AHL20(3)
                   <---------AHL20(3)
                   --------->AHL12(3)
                   <---------AHL20(2)
                   --------->AHL20(2)                                                             --
                   <---------AHL12(3)                                                             --
                   --------->AHL25(1)                                                             --
                   <---------AHL25(3)                                                             <-
                   --------->AHL25(2)                                                             <-
                  --------->AHL12(3)                                                ----------------
                  <---------AHL12(3)                                                <---------------
                  --------->AHL20(2)                                <---------AHL25(3)            <-
                  <---------AHL20(2)                               <---------ATHB51 <---------YAB1--
                  --------->AHL25(1)                               <---------AHL25(1)             <-
                  <---------AHL25(3)                               --------->AHL20(2)            ---
                  --------->AHL25(2)                               --------->AHL25(2)            ---
                  --------->AHL12(1)                   <-------TEIL--------->AHL25(1)            <--
                  <---------AHL12(1)                 <---------SPL7(1)          --------->ARR11(3)--
                  <---------AHL20(1)                <---------bZIP60(1)         <---------RVE1(2)---
                  <---------AHL25(2)                --------->bZIP60(1)         <---------ARR11(3)<-
                  --------->AHL25(3)                ================================================bZIP_DOF
                 --------------->AGL15              <---------TGA1a<---------AHL25(2)            <--
                 --------->AHL25(3)                 <---------bZIP60(2)         <---------GLK1(2)---
                 ===================================================================================
                 <---------------AGL15              <---------ANAC58<---------AHL12(1)      --------
                --------->WOX13(2)                  <---------ANAC58--------->AHL12(1)   ---------->DOF2
                <---------WOX13(2)                  --------->TGA1a--------->AHL25(3)    --------->DOF5.7(1)
                --------->AHL12(2)       =====================bZIP_DOF          --------->GATA12 ---
            --------->TOE2(3)--------->ICU4        --------->RAP2.6(3)        ----------->ARR10  <--
      --------->HSFB2a(2)    <---------ATHB51     <---------TGA2(2)<---------AHL12(1)<--------------
      <---------HSFB2a(2)  --------->YAB1<----------DOF2 --------->LBD16  <---------At4g35610   ----
   <----------DOF2<---------AHL25(1)    <---------DOF5.7(1)        --------->AHL12(1)--------->YAB1<
-------->DOF2 --------->AHL20(2)<---------YAB5   ----------->HVH21 --------->AHL20(3)---------------
 
ttaaagcttttggaaacttaattaatttagtaataatggtttctctttctacatgacgtccgtagtccaaattattcagataagattttcataaaaggaa  4892400
   <---------TOE2(3)
------->AHL20(3)
------->AHL20(1)
------->AHL20(2)
--------AHL20(3)
--------AHL20(1)
->AGL3
--AGL1
--------AHL25(3)
------->AHL25(2)
--------AHL12(1)
------>AHL12(3)
------>AHL12(2)                                                          <---------AHL25(3)
-------AHL12(3)                                                          <---------AHL20(2)
------->AHL12(1)                                                        --------->AHL25(1)
------>AHL25(1)                                                         --------->AHL20(2)
--------AHL25(2)                                                        <---------AHL25(1)
-------AHL12(1)                                                         --------->AHL25(3)
------>AHL12(1)                                                         <---------AHL20(2)
==MADS_MADS                                                             <---------AHL25(3)
--->GT1    --------->AHL12(1)                                         --------->WOX13(2)
------>AHL25(3)                                                       --------->AHL12(2)           <
-------AHL25(1)    <---------ARR11(3)                                 <---------AHL12(2)           <
-AGL15     <---------AHL12(1)                                         <---------WOX13(2)       <----
----->AHL25(3)   --------->ANAC58                                   <---------AHL20(2)   -----------
---------AHL12(2)--------->ANAC58                                ----------->GT1         -----------
>AGL15 --------->AHL20(2)                                <---------ZAT6 <---------AHL20(3)     <----
 
atattttagattaaaaaatcaagaaattcaaaactgtttctagttttgttttgttttctagtgttttgaagttaattaaatgttctaaagtttcagtact  4892500
                      <---------WRKY45
                      <---------WRKY12
         --------->AHL20(3)
         <---------AHL20(3)
         <---------AHL25(1)
         <---------AHL20(2)
       --------->AHL12(2)                                      --------->TGA2(2)                   -
      --------->AHL12(2)               <---------ANAC58      --------->ANAC55(2)                   -
     <---------AHL20(2)       ----------->GT1                --------->ANAC58                      -
---------ANAC58       <---------WRKY38(1)                    --------->ANAC58                      -
---------ANAC58      --------->WRKY18(1)<----------DOF2      --------->ANAC46                     <-
------DOF2          <-----------HVH21  <---------ANAC58     ------->TEIL                 --------->HSFB2a(2)
---->AtSPL8     ------>ZmHOX2a(1)<---------AHL20(2)     <---------------AtSPL3           <---------HSFB2a(2)
---->AtSPL3 <-----------GT1  ----------->GT1            --------------->AtSPL8 <----------DOF2    --
-----DAG2--------->AHL12(3)<------ZmHOX2a(1) ----------->GT1<-------TEIL--------->AHL25(3)    <-----
 
ttacttgtttatttttttcctctggtcaaaggatgttaaattgctttgtagtaaaactctatgtacgtcatagtttttatttctttgtttttctacaaat  4892600
 --------->TGA2(2)
<-----------TGA1
<-----------HVH21
-------->ANAC55(2)
-------->ANAC58                                     --------->ICU4
-------->ANAC46        --------->ANAC55(2)          <---------YAB1        --------->DAG2
-------->ANAC58      <-----------GT1              <-----------GT1    <---------TOE2(3)
------TEIL         <----------DOF2                ------->TEIL       <---------TOE1(3)          ----
----->TEIL<---------AHL12(2)  ---------->DOF2 ------->TEIL   --------->AHL12(2) <---------RVE1(2)
----------AtSPL3   <---------DAG2      <---------GLK1(1) <-----------GT1 ---------->DOF2        ----
 
gtacgtcaccaaaaaaaaacaactttacgttttaaaagatagatttctgtatgtaactattgacaatttttgaaggtaaagttgatttttgtgaagcaca  4892700
<- Previous    Next ->

AGI:  At1g14330.1   
Description:  kelch repeat-containing F-box family protein. similar to kelch repeat-containing F-box family protein [Arabidopsis thaliana] (TAIR:AT2G02870.2); similar to kelch repeat-containing F-box family protein [Arabidopsis thaliana] (TAIR:AT2G02870.1); similar to kelch repeat-containing F-box family protein [Arabidopsis thaliana] (TAIR:AT2G02870.3); similar to unnamed protein product [Vitis vinifera] (GB:CAO48419.1); contains InterPro domain Kelch repeat type 1 (InterPro:IPR006652); contains InterPro domain Kelch-type beta propeller (InterPro:IPR015915); contains InterPro domain Kelch related (InterPro:IPR013089); contains InterPro domain Galactose ox
Range:  from: 4890113    to: 4892246    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.