Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
     ----------->ARR10
--------->DOF5.7(1)
-------->DOF2
--NtERF2                        --------->SPL7(1)
>NtERF2                        <<<<<<<<<SPL1                        <---------ANAC58
-->ARR14(2)                    <<<<<<<<<SPL5                        <---------ANAC46               <
---ARR14(2)                    <<<<<<<<<SPL4--------->DEAR3(1)      <---------ANAC58            <---
-->ARR11(2)                   <---------SPL7(1)    --------->HSFB2a(2)                          ----
---ARR11(2)        --------->ALFIN1       <---------At5g28300      <------NtERF2      <---------RAP2.6(2)
->ATERF1(1)      <---------REM1(1) --------->At5g28300 ----------->RAV1(1)            <---------ANAC46
->At4g35610      <-----------RAV1(1)     <---------WRKY38(1)      ------>NtERF2       <---------ANAC58
-RAP2.3(1)  --------->O2    <---------------AtSPL8 <---------HSFB2a(2)                <---------ANAC58
-ATERF1(1)  <---------O2<-------GAMYB  <-----------HVH21--------->At4g35610          <---------LBD16
 
cgaaagccgagagcctcgtgatgttggggttattgtacggtgagtcaccgcgttcgagcagcaaaacgctggcgttttgagacagcgttgcggctagagg  4280500
             <---------ALFIN1
             --------->AtMYB61
             --------->DEAR3(1)
          <---------ALFIN1                                            <---------KAN1
       --------->PCF2                                              --------->LBD16
   <------NtERF2                                                  --------->ANAC58     <---------ZAT2
   <---------MYB52(1)      --------->KAN1                        <---------LBD16       --------->At4g35610
  --------->LBD16       --------->ARR11(3)                      --------->SPL7(1)      --------->ZAT2
  <-----------HVH21   <---------YAB1                          <-----------HVH21        <---------At4g35610
 --------->ANAC46   --------->YAB1                           <---------ANAC58         --------->ARR11(2)
 --------->ANAC58   --------->YAB5               <------ZmHOX2a(1)--------->ANAC58    --------->ARR14(2)
 --------->ANAC58  <---------ATHB12   <---------TOE1(1)  <-----------HVH21            <---------ARR14(2)
<---------LBD16 --------->DEAR3(1)    <---------TOE2(1) ------>ZmHOX2a(1)            <--------------
---------ATERF1(1) --------->ICU4    --------->SPL7(1)  <-----------RAV1(1)=========================
------ZAT18 <---------MYB55(2)     <---------SPL7(1)  ----------->RAV1(2)  <------ZmHOX2a(1)    ----
----->ZAT18 --------->MYB46(3)<---------YAB5<---------REM1(1)<---------ANAC58  --------->KAN1 <-----
 
gcacccggcagtcccaccaccgatgatgatatagtcgtagtacgacgttgtaggacttcctgtcgcgtcccgcatgaaggagtagttcggagctgcgatc  4280600
                                                                  <----------DOF2
                                                              <-----------GT1
----------->GT1                        --------->GLK1(2)   <---------ICU4   <----------ID1
-------WRI1                           <---------GLK1(2)    <---------KAN1--------->At4g35610       -
=HOX2a_HOX2a                    <---------ANAC55(2)       ------->TEIL   <---------At4g35610      --
------>DOF2                --------->YAB5              <---------YAB1<-----------HVH21            --
-ZmHOX2a(2)               <---------YAB1      <---------REM1(1)  --------->TOE2(3)          --------
 
aaagggtaaaactataacttcgcactaatatgaatacttaagaatctagttgtagttcatgaatattacctttgtcagaagaacaaattggagaatggag  4280700
                                               <---------ICU4
                                             --------->TOE2(3)
                                            <--------HAHB4
                                            --------->YAB5
                                            --------->ATHB12
                                            <---------ICU4
                                            --------->YAB1
                                           --------->ICU4
                                           <---------ATHB12
              ------->GAMYB       --------->GATA12
             --------->MYB46(3)   --------->ARR11(3)
           ----------->RAV1(1)    <-----------ARR10
--------->DOF5.7(1)               <---------ARR11(3)
-------->DOF5.7(1)                --------->GLK1(2)
-------->DOF2<---------MYB52(2)   --------->RVE1(2)
------->DOF5.7(1)    --------->RVE1(2)   --------->WOX13(1)                      <---------ZAT6
--->GT1   <----------ID1   <---------WRKY18(1)<---------YAB1          --------->GLK1(2)     <-------
 
aaaaagagagagagcaacaaacaatctccatgaccaaaatctatccatcattaatacaaattgagtttagcacaatctagagtagagttctctcactttg  4280800
                                                                         <----------DOF2
                                                             <---------AHL25(3)
                                                             <---------AHL25(1)
                                                             <---------AHL20(2)
                                                             --------->AHL20(2)
                                                            --------->AHL25(3)
                                                            --------->AHL25(1)
                                                            --------->AHL20(3)
                                                            <---------AHL12(3)
                                                            --------->AHL20(2)      <-----------TBP
             --------->YAB5                                 <---------AHL20(3)      --------->AHL12(3)
             --------->YAB1                                <---------WOX13(2)       --------->AHL20(2)
            <---------YAB1                                 --------->WOX13(2)--------->YAB1
   <---------ARR11(2)                   <----------DOF2    *TSS         <---------DOF5.7(1)
   <---------ARR14(2)             ---------->DOF2    ----------->GT1    <---------DAG2
---DOF2  ------->TEIL          --------->YAB1----------->HVH21  --------->KAN1 <---------YAB5    ---
 
tatgcctatatgtatatgataatgtatgggttatttataaagtctttggtgacctatggtgaaattaatactcgaccttttcatcatatatatagctaga  4280900
                                                                       ----------->RAV1(2)
                                                                       --------->At4g35610
                                                                       <---------At4g35610
                                                                 -------->ABF1
                                                                 <-------MYC3
                                                                 ------->MYC3
                                                                 <-------MYC2
                                                                 ------->MYC4
                                                                 ------->MYC2
                                                                 <-------MYC4
                                                                --------->O2
                                                                --------->ANAC55(2)
                                                                <---------ANAC55(2)
                                        <---------GLK1(2)       <--------ABF1
                                      <---------YAB1            <---------TGA1a
                                 --------->REM1(1)       --------->WOX13(2)
                               ----------->RAV1(1)    <---------AHL20(2)
                          --------->GLK1(1)           --------->AHL20(3)
                         --------->ARR11(2)           <---------AHL25(1)
                         --------->ARR14(2)           <---------AHL20(3)
    --------->DOF5.7(1)  <---------ARR14(2)           --------->AHL20(2)                   ---------
  ---------->DOF2        <---------ARR11(2)          --------->YAB1<-----------HVH21   <---------WOX13(2)
  --------->YAB1        <------ZmHOX2a(1)--------->GLK1(2)      --------->TGA1a    --------->At4g35610
--------->CBF         <---------TOE2(3) <---------ARR11(3)      <---------O2      ----------->GT1
 
aacaataaagagtccatctaattctgaggaaatgcaacatcaagattctatgtctattttaatggacacgtgtcacctgaagaagcagataaataagacc  4281000
                   --------->WOX13(2)
                   <---------WOX13(2)
                  <---------AHL12(2)
                 --------->AHL25(3)
                 --------->AHL25(1)
                 <---------AHL25(3)
                 --------->AHL12(1)
                 --------->AHL12(3)
                 --------->AHL20(2)
                 <---------AHL20(2)
                 <---------AHL12(3)
                 <---------AHL25(1)
                 <---------AHL12(1)
                 <---------AHL25(2)
                <---------AHL20(2)
                <---------AHL20(1)
                --------->AHL25(2)
                <---------AHL25(2)
                --------->AHL25(3)
                <---------AHL25(1)
                <---------AHL20(3)
                --------->AHL20(2)
                --------->AHL12(3)
                --------->AHL20(3)
                --------->AHL25(1)
              <---------AHL12(2)
              <---------WOX13(2)
              --------->WOX13(2)
             <---------AHL20(2)
             --------->AHL20(2)
             --------->AHL12(3)
             <---------AHL20(3)
             <---------AHL12(3)
             --------->AHL25(1)
             --------->AHL20(3)
             --------->AHL25(2)
             <---------AHL25(3)
            <---------AHL12(3)
            --------->AHL25(1)
            <---------AHL25(1)
            --------->AHL12(1)
            --------->AHL12(3)
            --------->AHL25(2)
            --------->AHL20(2)
            <---------AHL25(2)
            <---------AHL20(2)
            <---------AHL25(3)
            --------->AHL25(3)
            <---------AHL12(1)
            <---------AHL20(1)
           --------->AHL25(3)
          <---------AHL12(2)
          <---------WOX13(2)
          --------->WOX13(2)
         <---------AHL25(3)
        --------->AHL20(2)
        <---------AHL20(2)
        <---------AHL25(2)
        --------->AHL20(1)
        --------->AHL25(2)
        --------->AHL25(3)
        --------->AHL12(3)
        <---------AHL12(1)
        <---------AHL25(1)
        --------->AHL12(1)
        <---------AHL25(3)
        <---------AHL12(3)
        --------->AHL25(1)
       --------->AHL20(2)
       <---------AHL12(3)
       <---------AHL20(3)
       <---------AHL20(2)
       <---------AHL25(2)
       <---------AHL25(1)
       --------->AHL25(3)                                                     --------->AHL12(2)
       --------->AHL20(3)                                                     --------->AHL25(1)
       --------->AHL12(3)                                                     <---------AHL20(2)
      --------->WOX13(2)                                                      <---------AHL25(2)
      <---------WOX13(2)                                                      <---------AHL12(3)
      <---------AHL12(2)                                                     --------->AHL25(3)
      --------->AHL12(2)                                                     --------->AHL20(2)
    <---------AHL12(1)                                                  <---------ANAC46
    --------->AHL20(2)                              <---------YAB1 ------>MYB83<---------AHL12(2)
    --------->AHL12(1)                            --------->YAB1   --------->MYB52(1)            <--
    --------->AHL25(3)                            --------->YAB5   ------>MYB46(1)    <---------LBD16
  >>>>>>>>>GATA-1--------->AHL25(2)     <---------At4g35610  --------->DOF5.7(1)--------->AHL12(1)
>DOF5.7(1)--------->AHL12(2)            --------->At4g35610---------->DOF2----------->GT1   <-------
 
caatagataaattaattaatttaatttcaagaaaatgcaagttagatgaagtatcatgagagaaaagaccaaatggccgataaaatttctagggaatgta  4281100
                                                                              --------->AHL12(3)
                                                                              --------->AHL12(1)
                                                                              <---------AHL20(2)
                                                                              <---------AHL12(3)
                                                                              <---------AHL12(1)
                                                                             --------->AHL25(3)
                                                                             --------->AHL20(1)
                                                                      <---------RVE1(2)
                                                                    --------->MYB59
                                                               <---------YAB1<---------AHL20(1)
                                              <---------GATA12<---------AHL25(3)
                                             <---------GLK1(1)<---------AHL25(2)
                                    --------->YAB5            --------->AHL12(3)
                  ----------->RAV1(2)        --------->GLK1(1)<---------AHL25(1)
             --------->ANAC46      <---------YAB1             --------->AHL25(1)
             --------->ANAC55(1) --------->CCA1(2)            <---------AHL12(3)
  <---------RVE1(2)             <---------ARR11(2)            --------->AHL25(2)        --------->WOX13(2)
  <---------ARR11(3)            <---------RVE1(2)             <---------AHL20(2)      <---------AHL20(2)
  <---------ARR14(2)            --------->ARR14(2)            --------->AHL20(2)    --------->ANAC55(2)
  --------->ARR11(3)  <---------CCA1(2) ---------->DOF2      --------->YAB1  <---------ARR11(3)
-------REM1(1)  <-----------GT1 --------->ARR11(2)           --------->AHL20(2)    <---------TOE2(3)
--KAN1  <---------RVE1(2)       <---------ARR14(2)           --------->AHL25(1) <---------AHL20(3)
 
atgtagatattgatacacttaacctgtctctcttggatatgaataaagaaatctgaaattggaattaaaattagatactatatatttatgtaattgtgtt  4281200
                                   <-------GAMYB
                                  <------MYB83
                                  <------MYB46(1)
                                  <---------MYB46(3)                                       ---------
                                <---------MYB52(1)                                        <---------YAB1
                        --------->WOX13(2)                                              --------->YAB1
                       --------->YAB1                                           ------>ZmHOX2a(2)
                    <---------WOX13(2)                         ------>MYB83   --------->GATA12
                   --------------->AGL15                       ------>MYB46(1)<---------GATA12
                  ----------------->AGL2                      ----------->RAV1(1)       --------->YAB5
                  <-------TEIL >>>>>>>>>TAC1               ------->TEIL    --------->HSFB2a(2)
              ------>MYB46(1)  <-------GAMYB             --------->ZAT18   <---------HSFB2a(2)
              ------>MYB83 ------------>AtMYB77     <---------AHL20(2)<---------ANAC58 <---------YAB5
  <---------ANAC46----------------->AGL3            --------->AHL20(2)<---------ANAC58 <---------YAB1
 
tcagtgtgtgtaataccaacgtccattaatagacagttggttacagacttacagtttaaatgcaccaacattttcgttctcgatcgtgtgatcataataa  4281300
                     <--------ATHB1
                     --------->YAB5
                  --------->YAB1
                 --------->ICU4
            ----------->GT1
         <---------ANAC46
         <------MYB83-------->HAHB4
         <------MYB46(1)
        --------->MYB111(1)
        --------->MYB46(2)                 ----------->GT1
        --------->MYB55(2)               <---------TOE2(2)
        --------->MYB52(2)               --------->SPL7(1)
        --------->MYB59                  <---------TOE1(2)            <---------ANAC46
        <---------AtMYB61   <---------AHL20(2)--------->AHL20(2)      --------->ANAC55(2)
        --------->MYB111(2) --------->AHL20(2)<---------AHL20(2) --------->ZAT6
       <---------MYB55(1)--------->YAB1<---------SPL7(1)         --------------->AtSPL3
    <---------YAB1<---------ICU4      <---------ANAC58 ----------->GT1<---------ANAC55(2)
  <---------KAN1 <---------ATHB51     <---------ANAC46 --------->ANAC58   <---------KAN1
 <---------ARR14(2)  --------->ATHB12 <---------ANAC58 --------->ANAC58  ------->TEIL
 --------->ARR14(2) <---------YAB5   <---------------AtSPL8      <---------------AtSPL3
 --------->ARR11(2) --------->ICU4   --------------->AtSPL8      <---------------AtSPL8  --------->AHL12(2)
 <---------ARR11(2) <---------YAB1   --------------->AtSPL3 --------->WOX13(2)  --------->ANAC46
>YAB1 <---------MYB52(1)<-------TEIL <---------------AtSPL3 <---------WOX13(2)--------->KAN1
 
gccgaatatgttaggtggaaataatgattcataaattggtttcgtacgtttaaatgaaacgaaaattagcagtacgtatatatactccagtttttttttt  4281400
<- Previous    Next ->

AGI:  At1g12570.1   
Description:  glucose-methanol-choline (GMC) oxidoreductase family protein. similar to glucose-methanol-choline (GMC) oxidoreductase family protein [Arabidopsis thaliana] (TAIR:AT5G51950.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO63653.1); contains InterPro domain Glucose-methanol-choline oxidoreductase, C-terminal; (InterPro:IPR007867); contains InterPro domain Glucose-methanol-choline oxidoreductase; (InterPro:IPR012132); contains InterPro domain Glucose-methanol-choline oxidoreductase, N-terminal; (InterPro:IPR000172)
Range:  from: 4277991    to: 4280860    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.