Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                ------>ZmHOX2a(1)                                                --------->DEAR3(1)
       --------->LBD16                                                          --------->RAP2.3(1)
       <------NtERF2                                                           --------->LBD16
       ------>NtERF2                                                           <---------ATERF1(1)
      --------->RRTF1(2)                                                       ------>NtERF2
      --------->ANAC46                                                        --------->ANAC46
      --------->RRTF1(3)                                                      --------->DEAR3(1)
      --------->RAP2.3(2)                                                    <---------LBD16<-------
      --------->RAP2.6(2)                                       ------>ZmHOX2a(1)--------->RAP2.3(2)
      --------->DEAR3(1)        ------>ZmHOX2a(1)  <----------DOF2        <---------At4g35610
     --------->RAP2.3(1)   <---------ANAC58        <---------DAG2 --------->SPL7(1)<---------DOF5.7(1)
     <---------LBD16       <---------ANAC58        <---------DOF5.7(1)    --------->At4g35610
 ------>ZmHOX2a(1)  ------>ZmHOX2a(1)   <---------ARR11(3)      --------------------->WRI1<---------
tctccttcgccgcaatctccttcctcacttgcttcctcttcaatttcttcatcgcttttcgcttctccttacgactcatctccgccgctttctctttact  3388300
                                 <-----------RAV1(1)                                  --------->TOE1(3)
                               <---------ANAC58                                       --------->TOE2(3)
                               <---------ANAC58                                      <---------ANAC58
                          <----------DOF2                                            <---------ANAC58
                        ------>NtERF2                                                <---------ANAC46
                        <---------At4g35610                                          <---------ZAT6
                       --------->RAP2.3(2)               <---------MYB52(1)       <--------P
                       --------->DEAR3(1)              <---------ANAC58         --------->LBD16
                      --------->RAP2.3(1)              <---------ANAC58        --------->LBD16
                      <------NtERF2                <---------DAG2          <-----------GT1
                     ------>NtERF2                 <----------DOF2      --------->AHL20(3)
                     --------->LBD16               <---------DOF5.7(1)  <---------AHL20(2)
                    --------->ANAC46              <---------DOF5.7(1)  <---------DOF5.7(1)
>ZAT14             <---------LBD16                <------------------------ANAC81<---------MYB52(1)<
----GT1            --------->MYB46(3)        <<<<<<<<<TBF1   <---------ANAC58 <---------LBD16     <-
-DOF2  <----------DOF2--------->DEAR4(2)<---------DOF5.7(1)  <---------ANAC58<---------LBD16      <-
ctcttcaaaactttccttctctcccgccgcttcttcgtgtcgctcttcttcttccttttcgtttgcttgctccatttttttcccggtagcgttaacctct  3388400
         <---------ANAC46             <---------ARR11(2)
       --------->MYB55(2)             <---------ARR14(2)
       <---------MYB46(3)             --------->ARR14(2)
      --------->ALFIN1--------->AHL25(1)                                                 -----------
      <---------DEAR3(1)<---------WOX13(2)     <---------WOX13(2)                    --------->DOF5.7(1)
      <---------AtMYB61 --------->WOX13(2)    --------->MYB52(2)<---------ZAT14     <---------AHL12(3)
<---------REM1(2)    --------->AHL20(2)     <--------P    --------->MYB52(1)        <---------AHL20(2)
----------->HVH21    <---------AHL20(3)     <---------MYB52(1)  --------->ZAT14     <---------AHL20(3)
----------DOF2       --------->AHL20(3)    <-------GAMYB --------->ARR11(2)        <---------AHL25(3)
--------ANAC58       <---------AHL25(2)  --------->MYB59 <---------ARR11(2)        --------->YAB1
--------ANAC58    <---------GLK1(2)  --------->KAN1  <-----------------AGL1  ----------->GT1   <----
ggcttcacggtggtggaaacagaatttaatttaggggtgcaaattcggttagtttgaaccgaaacggtatagtgaagaaatcgaaataaaaatggattaa  3388500
                       <---------MYB46(3)                        <---------ZAT2
                       <------MYB83                           --------->LBD16
                     <--------P                         <---------ANAC58
            --------->GLK1(1)               --------->KAN1   --------->DEAR3(1)
            <---------GLK1(1)               <---------ATERF1(1)<------NtERF2
         --------->LBD16                --------->TOE1(1)   <---------LBD16                        <
>GT1   <---------LBD16 <------MYB46(1) <---------LBD16  <---------ANAC58    --------->YAB1         -
-------GT1  <---------ATERF1(1) <------------CBF    <------------CBF <---------HSFB2a(2)    ------>ZmHOX2a(1)
accatactaaaccggagacccctagttggttcacctattgacctcggagactccaaattgctcgccggagctctcgaaatcagaaaactttcatcctctt  3388600
                                 --------->KAN1 <----------DOF2
                                --------->ARR11(3)                   <---------ICU4
                           <-----------HVH21 <-----------GT1         --------->YAB5
             ------------>CBF   <---------ARR11(3)    <------------CBF
          <---------WOX13(1)    <---------RVE1(2)   <---------YAB1   --------->KAN1<---------HSFB2a(2)
         <------------CBF <----------DOF2 ----------->GT1           <---------YAB5 --------->HSFB2a(2)
---------At4g35610     <---------ALFIN1<---------RVE1(2)            <---------ATHB12               <
-------->At4g35610  <-----------GT1  <---------AHL20(2)            <---------ARR11(3)             --
gtagctcaagccgattgacaatttctccactttcagatatttgatttgtaactttctcattgaaattcaaaatcattctccatcttctacaacgaggtct  3388700
           <---------ANAC58  <---------ICU4                                               <---------ALFIN1
<----------DOF2     <---------WOX13(1)                                                  --------->ANAC58
---------DOF5.7(1) <------------CBF    <------------CBF                                 --------->ANAC58
-------->ID1<----------DOF2 <---------YAB5       --------------->AtSPL8  <---------MYB52(1)------->TEIL
cgtctttttgttttgctttgtagattgcttaatctttgtgcaaattgtatgcgttgtacttccttctcaagtttcagtttgtctcttgaagacgcacttc  3388800
                                             --------->ANAC46                    --------->HSFB2a(2)
                                          <-------TEIL                           <---------HSFB2a(2)
                                        <---------GLK1(2)                 <--------P
                                        --------->ARR14(2)               <---------ANAC58
                                        --------->ARR11(2)               <---------ANAC58
                                        <---------ARR11(2)              <---------MYB46(3)
                                        --------->GATA12          --------->ANAC58                 <
                                        <---------GATA12          --------->ANAC58          --------
                --------->KAN1      <---------At4g35610      --------->ANAC46<---------ANAC46      <
            <---------ANAC46     ---------->DOF2             --------->ANAC58<---------ANAC58      <
      <---------TOE1(2)     --------------->AGL15    <----------DOF2   <---------AtMYB61    --------
  --------->HSFB2a(2) ------>ZmHOX2a(1) <---------ARR14(2)   --------->ANAC58<---------ANAC58  -----
atcttctccaacgtttcttatactcctcaaaccagattaagcagattcacacagttcttttgaccagcaacgcattggttgcttcgagatggaagacgaa  3388900
                                  <-----------RAV1(2)                                           ----
       --------->ZAT14           <---------ZAT14                                              ------
     --------->ANAC46    --------->RVE1(2)                                       --------->ANAC58
     --------->REM1(1)  ------>ZmHOX2a(1)                                  <---------ANAC58  -------
---------ANAC58      <------ZmHOX2a(2)                                     <---------ANAC58 ------>MYB83
->ANAC58             =======================HOX2a_HOX2a                  <---------YAB1     ------>MYB46(1)
---------ANAC46     <---------GATA12                                   --------->KAN1       --------
---------ANAC58     --------->GATA12 <------ZmHOX2a(1)               --------->YAB1    --------->RVE1(2)
->ANAC58<---------ALFIN1<---------CCA1(2)                       <---------ZAT14  --------->ANAC58  <
---->KAN1     --------->KAN1     --------->ZAT14                --------->ZAT14  --------->ANAC46<--
atgcgtctacaacactctcattcgatcctatctcactacaggagaatacaagacttctcttgctctcttcactcatatgcttgcaagccatgtccaacca  3389000
                              <---------ANAC58                 ----------------->AGL1
       <----------DOF2        <---------ANAC58              --------->ATERF1(1)
-->MYB83                     <---------At4g35610           <-------GAMYB
-->MYB46(1)                  --------->ZAT2               <---------ANAC58
->GAMYB<---------DAG2        --------->At4g35610          <---------bZIP60(2) --------->ARR11(3)
-->MYB46(3)                  <---------ZAT2        <---------ANAC58           <---------ARR11(3)
>P--------->TOE2(3)    ---------->DOF2             <---------ANAC58 <---------AtLEC2
-----------GT1     --------->YAB5       <----------DOF2   <---------ANAC46  --------->ANAC58
-------MYB52(2)   <---------YAB1       <---------DOF5.7(1)<---------ANAC58  --------->ANAC58
aataacctcactttcccttctctgattaaagcagcttgctcatctttctctgtttcttatggcgttgccttacatggccaagctcttaaacggggttttc  3389100
       <---------MYB52(1)                                                         <---------AHL12(1)
    <-------TEIL                                                                 <---------CCA1(1)
    ------>ZmHOX2a(2)                                                            <---------RVE1(1)
   <------ZmHOX2a(2)                                                            <---------ARR11(3)
  --------->ARR11(2)                                                            --------->ARR11(3)
  <---------GATA12                            <------MYB46(1)         <---------ARR11(3)
  <---------ARR11(2)           --------->ARR11(2)          <---------ZAT2      --------->YAB1      <
  --------->GATA12             <---------ARR11(2) <---------RVE1(2)   --------->ARR11(3)<-----------GT1
  --------->ARR14(2)       <---------LBD16    ----------->GT1     <------ZmHOX2a(1)    <-----------GT1
  <---------ARR14(2) <----------DOF2          <------MYB83 --------->At4g35610<---------YAB1    <---
tatgggatccatttgttcagacttcttttgtccggttctatggtgaagttggtgatttggagagctcgaggaagatgtttgatgatattttaaacccttg  3389200
<- Previous    Next ->

AGI:  At1g10320.1   
Description:  U2 snRNP auxiliary factor-related. similar to ATU2AF35B, RNA binding [Arabidopsis thaliana] (TAIR:AT5G42820.1); similar to ATU2AF35A, RNA binding [Arabidopsis thaliana] (TAIR:AT1G27650.1); similar to ATU2AF35B, RNA binding [Arabidopsis thaliana] (TAIR:AT5G42820.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO46909.1); contains InterPro domain Zinc finger, CCCH-type; (InterPro:IPR000571); contains InterPro domain RNA recognition, region 1; (InterPro:IPR003954); contains InterPro domain RNA recognition motif, RNP-1; (InterPro:IPR000504); contains InterPro domain Nucleotide-binding, alpha-beta plait; (InterPro:IPR012677); contains
Range:  from: 3384166    to: 3388375    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g10330.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:AT5G66520.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN60147.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 3388749    to: 3390152    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.