Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
     <------ZmHOX2a(2)                                                           --------->ARR11(2)
     <---------KAN1                                                              <---------GATA12
     --------->GLK1(1)                                                    --------->YAB1
    <---------ARR14(2)                                                  <---------AHL20(3)
    <---------GATA12                                                    --------->AHL20(3)
    --------->GATA12                                                --------->TOE2(3)
    --------->ARR11(2)                                             <-------TEIL  <---------ARR11(2)
    --------->ARR14(2)                                            ====================HOX2a_HOX2a
    <---------ARR11(3)                                           --------->AGP1------>ZmHOX2a(1)
    <---------ARR11(2)                                           --------->GATA12--------->RVE1(2)
    --------->ARR11(3)                                           <---------ARR11(2)
 <---------TOE1(2)                                               --------->ARR11(3)
--------->LBD16<---------YAB1                                    <---------GATA12--------->GATA12
------>ZmHOX2a(1)                                                <---------ARR11(3)
---------LBD16--------->AHL25(2)                                 --------->ARR11(2)
-------->TOE1(2) --------->WOX13(2)                        <-------TEIL--------->YAB1----------->RAV1(1)
--------->RAV1(2)<---------WOX13(2)              --------->RVE1(2)<------ZmHOX2a(2)------>ZmHOX2a(2)
ttcctgggatctccaattataatttagaaatcaaaaaccccagacaaaccaaaatcaacaaattcatagatccataataatcctgatccaacatttgaga  2976400
                    <---------ARR14(2)                                                    --------->ANAC58
                   ========================HOX2a_HOX2a                                ------>ZmHOX2a(2)
                   <------ZmHOX2a(1)------>ZmHOX2a(2)                               <---------GATA12
       --------->At4g35610   <---------AtLEC2              --------->TOE2(3)        --------->GATA12
       <---------At4g35610   <---------ANAC46      <---------KAN1      --------->WOX13(2) --------->ANAC46
   <-----------HVH21<---------ARR11(3)           --------->YAB1        <---------WOX13(2) --------->ANAC58
acaaactatcagatgaaaacgaggatatcgtagcatggatcttaaactcgtagcataaatcacattaaaactcaaattgaagaaatagatcgcaagccag  2976500
                   <------ZmHOX2a(1)                                     ===========================
            <---------YAB5                                               ------>ZmHOX2a(1)<---------ATERF1(1)
        --------->ANAC58                   <---------REM1(1)             --------->LBD16<---------At4g35610
        --------->ANAC58          <---------ZAT6                         --------->HSFB2a(2)  <-----
        --------->ANAC46      <---------ZAT14                  ---------->DOF2   --------->MYB52(1)-
  --------->MYB52(1)          --------->ZAT14        --------->MYB59     <---------HSFB2a(2)<-------
aacacaaacagacgcatcatcaggaagatagagtatagagatagagatgtagaaattagataccatcaaagcgctcctcgaaaataactgcggcggaggc  2976600
-------->ANAC58                                                             <---------At4g35610
----->ZmHOX2a(2)                         --------->YAB1                    <-----------ARR10
-----ZmHOX2a(2)                          <---------ICU4                 ------>ZmHOX2a(2)
-------GATA12                            <--------HAHB4                <------ZmHOX2a(2)      ------
>ATERF1(1)                              <---------YAB5                <---------ARR11(2)   <--------
======HOX2a_HOX2a           <---------TGA1a                           --------->ARR11(2)   ---------
=====HOX2a_HOX2a            --------->O2--------->ICU4                <---------GATA12 <---------ARR11(3)
-NtERF2                   --------->CCA1(2)    --------->ANAC46       <---------ARR14(2) <----------
-------->ANAC58    <---------KAN1    <------ZmHOX2a(1)                --------->GATA12 --------->GATA12
--DEAR3(1)    --------->YAB1<---------O2<---------ATHB12              --------->ARR14(2)<------ZmHOX2a(2)
gatcgcaacaagaccgataagaattagagagacgaggctaggaatcattttcgccattgctaaaaaaaactcagatcggagcttccccgagatcagatga  2976700
                                                      <---------At4g35610      <---------TOE2(3)
                                                    <---------ZAT18     --------->AHL20(2)
 --------------->AtSPL3                            *TSS                 --------->AHL25(3)
 --------->ARR11(3)                           --------->STY1(2)         --------->AHL25(2)
 <---------ARR11(3)                          --------->ANAC58           <---------AHL20(2)         -
 <---------------AtSPL8                      --------->ANAC58           <---------AHL25(1)         <
 --------->GATA12                         --------->ZAT2<----------DOF2 --------->AHL25(1)     <----
 <---------GATA12<---------At4g35610      --------->At4g35610           <---------AHL20(3)     -----
--->YAB5    <---------LBD16<---------At5g28300<---------STY1(2)         <---------AHL25(2)     -----
-At4g35610 ----------->RAV1(2)          <------ZmHOX2a(1)               --------->AHL20(3)     <----
>At4g35610--------->ARR11(3)          --------->ALFIN1--------->At4g35610  <---------YAB1 ----------
-RAV1(2)  <---------ARR11(3)       <------ZmHOX2a(1)--------->ZAT18  <---------RVE1(2)  <---------ANAC46
tgaagatgtacaagacctggagcttatatataccgcgaggagaggagctagcaagtgagctttgctctcatggattttattttaggctacgtcgtgtaaa  2976800
          <-----------------AGL1  <---------At4g35610
      --------->ANAC55(2)    --------->ANAC46
      <---------ANAC55(2)    --------->ANAC55(2)
      --------->ANAC46  ===============MYC_MYB
      --------->ANAC58 ================MYC_MYB
      --------->ANAC58 <------------AtMYB77
      --------->ANAC55(1)  <---------ALFIN1
      --------->O2     --------->MYB46(3)
  ------>NtERF2        --------->DEAR3(2)
-------->At4g35610   <---------ARR11(2)                  <---------bZIP60(2)
---------At4g35610   --------->MYB52(1)               <---------KAN1                            <---
-----ARR14(2)        --------->ARR11(2)       <------------CBF                             ---------
---->ARR14(2)     <---------ANAC55(2)       <---------YAB1                                --------->DOF5.7(1)
---->GATA12       --------->ANAC55(2)<-------TEIL <---------TOE2(3)                     ---------->DOF2
-----GATA12 ------------>CBF <---------ANAC55(2) --------->YAB1                 --------->DOF5.7(1)
->GT1 --------->bZIP60(2)<-----------HVH21  <---------YAB5                     --------->DOF5.7(1)
tctgcagccacgtaatccaataggtaaccgacacgtcagatacatttgtcattgagaatgacatgtcgttatagtattggataaaacgggagaaagaagg  2976900
                                    ---------->DOF2     <---------DEAR3(1)
                                ------->MYC3           <---------ZAT14
                                ------->MYC4        <------MYB46(1)
                                <-------MYC3        <---------MYB46(3)
                                ------->MYC2        <---------DEAR3(2)
                                <-------MYC2        <------MYB83
                                <-------MYC4       --------->ALFIN1
                               <---------ANAC55(2) <---------AtMYB61
                               <---------O2        --------->MYB111(2)
                               --------->O2        --------->MYB111(1)
                               <--------ABF1       <---------MYB46(3)
                               --------->TGA1a     <---------DEAR3(1)
                               <---------TGA1a     --------->MYB55(2)
           --------->TOE2(3)   ============================MYC_MYB
     --------->WOX13(2)   ----------->HVH21       <---------MYB55(1)
     <---------WOX13(2) --------->CCA1(2)         <--------P
    <--------HAHB4     <---------GATA12 --------->AHL20(1)
    --------->YAB5     <---------ARR11(3)--------->KAN1--------->ZAT18
    --------->ATHB51   --------->ARR11(1)--------->CCA1(2)--------->At5g28300                <------
    <---------ICU4 ---------->DOF2--------->REM1(2)--------->MYB46(2)                   <---------ANAC46
   --------->ICU4  ======================bZIP_DOF<-------GAMYB                      <----------DOF2
------DEAR3(1) --------->ANAC58<---------ANAC46 <---------MYB46(3)              --------->ZAT18
>DOF5.7(1) --------->TOE1(3)   --------->ANAC55(2)<---------MYB52(1)            <---------ZAT18 <---
ctgtgcataattagccttaagcaaaagatttgacacgtgtaaagatattagcggttggtgcggtgatataaacaaaaaacaagtgtgcttctcgtggaga  2977000
                    ------>ZmHOX2a(2)                 <-----------RAV1(1)
                   <---------GLK1(1)                  --------->MYB55(2)
                   --------->GLK1(1)                  --------->MYB111(2)
                   <------ZmHOX2a(2)                  --------->MYB52(2)
                  <---------ARR11(2)                  <---------MYB46(3)
                  <---------GATA12                <------MYB83
                  --------->ARR11(3)           <---------ANAC58
                  --------->ARR11(2)           <---------ANAC58
                  --------->RVE1(2)      <---------AHL25(3)
                  <---------ARR14(3)     <---------AHL20(1)                         <---------GATA12
                  <---------ARR11(3)     --------->AHL20(1)                         --------->GATA12
                  <-----------ARR10      --------->ARR11(3)                        --------->KAN1
                  <---------AGP1        --------->AHL12(1)                      <---------MYB52(1)
                  --------->ARR14(2)    <---------AHL12(3)                     <---------RAP2.6(3)
        ---------->DOF2<---------LBD16  --------->AHL12(3)                    <---------MYB46(3)
----------->GT1   --------->GATA12      --------->AHL20(2)                  <---------At4g35610
<---------ZAT6    <---------ARR14(2)    <---------AHL12(1)              ------>ZmHOX2a(2)       ----
---ANAC46 --------->DOF5.7(1)          --------->AHL12(2)             <---------ARR11(3)        <---
------ZAT14      <---------CCA1(2)----------->GT1 <------MYB46(1) --------->ANAC55(2)       ------->GAMYB
gtagagtaaacaaaagaagcagatctctcgggtgttttagtaaatatatagcttggtttgttggattaaacgtgatctcagccgttagattccaactgaa  2977100
            <---------AHL12(1) <------NtERF2                      <---------AHL25(2)
            --------->KAN1  <---------PCF2                        --------->AHL12(2)
   <---------GATA12      --------->ALFIN1                         --------->AHL25(1)
   --------->GATA12    <---------ANAC46                           <---------AHL12(3)
--------->AHL20(2)     <---------ANAC58        <---------ANAC46  --------->AHL20(2)
<---------AHL20(2)     <---------ANAC58      <---------ANAC46    --------->AHL25(3)  <----------DOF2
----->AHL12(1)     ---------->DOF2       <---------WOX13(1)   ----------->GT1--------->YAB1
------AHL12(1)   <---------HSFB2a(2)<------ZmHOX2a(1)        ----------->GT1 --------->AHL20(2)
tttttaaatctacaaaaattctaaaagcgtgggccgagaggaagattgatgtgtgtattttgggccgataaaattttaaattataaatctttttgtgttg  2977200
                                        --------->GATA12                     ---------->DOF2
                                        --------->RVE1(2)              --------->ANAC58
                       <---------ANAC58 <---------GATA12               --------->ANAC58
                       <---------ANAC46 <---------ARR11(3)         --------->YAB5
                       <---------ANAC58 --------->GLK1(2)       <---------ICU4
                 --------->YAB5         <-----------ARR10       --------->YAB1                  ----
        <---------ANAC46   ---------->DOF2    <---------ANAC46<---------RVE1(2)   ---------->DOF2
atggtttttttgtgtgaagaagattagcgtaaaagctactcaaaatctgacttggattcaaatttgataatgacacccattgaagcaaagttttttcaaa  2977300
<- Previous    Next ->

AGI:  At1g09210.1   
Description:  calreticulin 2 (CRT2). Identical to Calreticulin-2 precursor (CRT2) [Arabidopsis Thaliana] (GB:Q38858;GB:O04152;GB:O80486;GB:Q94AW7); similar to CRT1 (CALRETICULIN 1), calcium ion binding [Arabidopsis thaliana] (TAIR:AT1G56340.2); similar to CRT1 (CALRETICULIN 1), calcium ion binding [Arabidopsis thaliana] (TAIR:AT1G56340.1); similar to Calreticulin precursor (GB:P93508); contains InterPro domain Calreticulin/calnexin, P; (InterPro:IPR009033); contains InterPro domain Calreticulin/calnexin; (InterPro:IPR001580); contains InterPro domain Endoplasmic reticulum targeting sequence; (InterPro:IPR000886); contains InterPro domain Concanavalin A-lik
Range:  from: 2972844    to: 2976752    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.