Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                            --------->KAN1                                                         -
                            <---------RVE1(1)                                                    ---
                            <---------CCA1(1)                                                    <--
                           --------->ARR14(2)                                                  <----
                           --------->ARR11(3)                        ----------->GT1           -----
                           <---------ARR11(3)                 <---------WOX13(2)               <----
                           <---------ARR14(2)                 --------->WOX13(2)               -----
                           <---------RVE1(2)                 --------->WOX13(1)                -----
                         ----------->ARR10                --------->ANAC46                     <----
                       <---------At4g35610                --------->ANAC58                     -----
                --------->YAB1                           ------->GAMYB                         <----
                <---------ICU4<---------YAB1            --------->MYB46(3)                     -----
     --------->ANAC46  --------->At4g35610             -------->P <---------TOE2(3)            <----
 --------->AtMYB61<---------ANAC55(2)                 --------->WOX13(1)                       <----
-->KAN1        <---------ATHB12         <---------WOX13(2)--------->ANAC58                    ------
-->YAB1      --------->WOX13(1)     ----------->GT1--------->TOE2(3)<------ZmHOX2a(1)         ------
acgaccacaagggactcaatcatgtgagcagatattatagggtaattgcaattacatcaaccagcaattaaggagaaaaacatacccattcaaactatta  2838000
    <---------KAN1                                                 <------ZmHOX2a(2)
-------->YAB1                                                      =============HOX2a_HOX2a
------>WOX13(2)                                                   <---------ARR14(2)
-------WOX13(2)                                                   <---------ARR14(3)
-----AHL25(1)                                                     --------->ARR14(3)
---->AHL25(1)                                                     <---------RVE1(2)
-----AHL25(3)                           ===================================HOX2a_HOX2a
---->AHL25(2)                           <------ZmHOX2a(1)         --------->ARR11(3)        <-------
---->AHL20(1)                         --------->LBD16             --------->GATA12      <-------GAMYB
-----AHL20(1)                        <-----------RAV1(2)          <---------GATA12      <---------At4g35610
---->AHL20(2)                        <---------LBD16              --------->ARR14(2)   --------->MYB52(2)
-----AHL20(3)                        --------->HSFB2a(2)         <---------GLK1(1)  <-----------HVH21
---->AHL20(3)                   --------->YAB5        <---------TOE1(3)    <---------GLK1(1)<-------
-----AHL20(2)                 -------->P==================================HOX2a_HOX2a<---------MYB52(1)
-----AHL25(2)        ---------->DOF2 <---------HSFB2a(2)         --------->GLK1(1) <---------ANAC46
--->AHL20(2)  <---------KAN1 <-----------GT1       <----------DOF2<---------ARR11(3)--------->LBD16
--->AHL25(3) ---------->TaMYB80----------------->AGL1<-----------RAV1(2) <------ZmHOX2a(1)  <-------
aattagaatataagggaatataagaaaagaaactaccattccaggagagaagcgcttcaggtttttggagatcttaggagatgcctccgtgagttgctgg  2838100
 --------->RVE1(2)                                                                          ========
 <---------ARR14(2)                                                    --------->At4g35610  <-------
 --------->ARR14(2)                                               <---------ZAT6         --------->GLK1(2)
 --------->ARR11(3)                                           --------->ZAT18  <---------ARR11(3)
<---------CCA1(2)                                             <---------ZAT14--------->ANAC58     <<
--ANAC58                          ------->TEIL                --------->ZAT14--------->ANAC58<------
--ANAC46                      --------->GATA12      ----------->GT1<-----------HVH21   --------->KAN1
--ANAC58                --------->KAN1              <---------ANAC46   <---------At4g35610  ========
tccatatctttggactcatcaggtttctcattcgatgtgcctagagggttttgaggcgttaaaactgcagtgtcagaggcaagaccattcacattctgtt  2838200
          --------->ZAT2                                                                        ----
          --------->At4g35610                                                              <------MYB46(1)
          <---------At4g35610                                                              <--------
        <---------WRKY38(1)                                                                <------MYB83
        <-----------RAV1(2)                                                                ---------
        <---------WRKY12                                                                   ---------
 ----------->RAV1(2)                             <---------YAB1                    --------->DAG2
====================RAV                      --------->GLK1(1)                     --------->DOF5.7(1)
----RAV1(1)           <---------YAB1         <---------GLK1(1)    <---------KAN1 ---------->DOF2----
<<<<<<<<WRKY26--------->ALFIN1         <---------WOX13(1)         --------->MYB46(3)  --------->ALFIN1
-GAMYB<-----------HVH21               <---------RVE1(2)      <---------TOE1(2) ----------------->AGL1
=============RAV    --------->CCA1(2)--------->ATHB12<---------KAN1    --------->At4g35610 <--------
gatcaactgggtcagcagtggaggtatgagagttggaagttgattgggagttctgaatatgtcgaaggaacaactgctggatgccaaaggtggaaggttg  2838300
   <---------KAN1                                                   <---------ARR11(2)
   <---------YAB5                                                  --------->GLK1(1)
------->TGA1                                                       <---------KAN1
-HSFB2a(1)                                                      <------NtERF2
>HSFC1(2)--------->At4g35610                          <----------DOF2
>HSFB2a(1)                          --------->At4g35610  <---------ANAC58
------->HVH21 <---------YAB1        <---------At4g35610  <---------ANAC58                    -------
-HSFC1(2)<---------At4g35610     ---------->DOF2     <---------DOF5.7(1)                 ------>NtERF2
tgacgaatgattagctgaagattgtttgtttgatttcaaagctgaagacttgggcttctttcttggtggcatttccaatggctaatacttggcaccctga  2838400
                                                                    <------------CBF             <--
                                                                   --------->ATHB12     <---------ARR11(2)
                    <---------ANAC58                              <---------YAB1        --------->ARR11(2)
                    <---------ANAC46                              <---------YAB5        <---------ARR14(2)
        <---------ZAT2           <----------DOF2                --------->YAB1          <---------GLK1(2)
        --------->At4g35610   <-----------GT1               <---------AHL20(2)          --------->ARR14(2)
 <---------YAB1     <---------ANAC58        <---------HSFC1(2) <---------YAB5        <------------MYB.PH3(1)
-->LBD16<---------At4g35610   <---------AHL20(2)    --------->HSFC1(2)             --------->MYB52(1)
aattttgatggagctgataaacttcgtgcatattaactttgccttgaaacttcgaaacttcatataatcttcattgtaattttgtataacggattcttat  2838500
--------->TOE2(3)            <---------KAN1 <----------DOF2
--------->YAB1             --------->YAB1--------->ARR11(3)             --------->MYB46(3)  --------
------->ARR11(3)       ---------->DOF2  --------->CCA1(1)--------->ANAC46         ------>ZmHOX2a(1)-
--------ARR11(3)   <----------ID1----------->GT1  <---------TOE1(2)--------->GLK1(2)        --------
-------CCA1(2)  ---------->DOF2---------->DOF2   <---------LBD16   --------->RVE1(2)---------->DOF2-
atatcttaatctgaaattcaaaagaacaaagcataaaagtaaaatacctttctcaggatcacgctgtgagaatcaacaacaagtcctgaaagtagttgac  2838600
          --------->KAN1                   --------->HSFB2a(2)
         --------->ARR11(2)                <---------HSFB2a(2)
       --------->LBD16                <---------At4g35610
      --------->ANAC46          --------->MYB52(1)                    <---------HSFB2a(2)
      --------->LBD16          <---------AHL25(1)                     --------->TOE2(3)
     --------->LBD16           <---------AHL20(2)                     --------->HSFB2a(2)
     <---------LBD16           <---------AHL25(3)                <---------HSFC1(2)
    <---------LBD16           <---------AHL25(2)                 <---------HSFB2a(1)
 --------->GLK1(2)            --------->AHL20(2)                 --------->HSFC1(2)
 <---------ARR14(2)           <---------AHL12(3)                 --------->HSFB2a(1)
 --------->ARR11(2)           <---------AHL25(1)                 --------->At4g35610
 --------->ARR14(2)           --------->AHL25(2)           <---------ZAT2
->WRKY12 <---------ARR14(2)  <---------WOX13(2)            --------->ZAT2
-------->HSFB2a(1)           --------->AHL12(2)            --------->At4g35610
--->HVH21--------->ARR14(2)  --------->WOX13(2)            <---------At4g35610  <---------KAN1
-------->HSFC1(2)   --------->KAN1    --------->At4g35610<-----------RAV1(2)   ------->TEIL      ---
gaagaatccccggaaattccagtaaattccaaaattaatggagcttccacaaacctagactcagcagaagcttccataaacgaacttcgctacctctgaa  2838700
                                                              -------->P                      <-----
                                                  --------->GLK1(2)                          <------NtERF2
                                                 <---------GATA12                            -------
                                                 --------->GATA12--------->ANAC46           ------>NtERF2
                                                 <---------GLK1(2)                          <-------
                                                 --------->ARR14(2)                --------->ANAC58-
                                                 <---------ARR14(2)   <---------DEAR3(1)   ---------
                                        --------->YAB1     <---------MYB52(2)      --------->ANAC58<
                                       ----------->GT1--------->LBD16 --------->ANAC58     ---------
      ---------->DOF2       --------->ANAC58    --------->At4g35610   --------->ANAC58     <--------
------>RVE1(2)              --------->ANAC58--------->RVE1(2)--------->MYB52(1)  ---------->DOF2----
aatcgcagacaaagttgagaattcagaaggaacgaaatggaaatgaaaatcagattccgaaaactaaccaggcacggcgaagtagaaagcaatggcgacg  2838800
   <---------DEAR3(1)                                                                   <------NtERF2
   ----------->HVH21                                                                  --------->DEAR3(1)
   --------->DEAR3(1)                                                               ------>NtERF2
  <------NtERF2                                                                     <---------ATERF1(1)
  --------->RAP2.3(1)                                                              --------->ANAC46
  --------->ATERF1(1)                                                     --------->WOX13(2)
 <---------RAP2.3(1)                                                      <---------WOX13(2)
 <---------ATERF1(1)                                                    --------->AHL25(3)
 ------>NtERF2                                            ------>ZmHOX2a(1)        --------->DEAR3(1)
--------->DEAR3(1)                                    <---------ARR11(2)--------->AHL25(2)
<---------DEAR3(1)                                    <---------ARR14(2)--------->AHL12(3)
---->NtERF2                                           --------->ARR14(2)<---------AHL20(2)
--------ATERF1(1)                                     --------->ARR11(2)--------->AHL20(2)
-------->HVH21                                 --------->HSFB2a(1)      <---------AHL12(3)
-------DEAR3(1)                                <---------HSFC1(2)       --------->AHL25(1)
------>DEAR3(1)                                --------->HSFC1(2)       <---------AHL25(1)
----->ATERF1(1)                               <---------TOE1(3)         <---------AHL25(3)
---NtERF2                                     <---------TOE2(3)        <---------AHL25(1)
->NtERF2                                      <---------------AtSPL3   --------->AHL20(3)
-----ATERF1(1)                             --------->ALFIN1            --------->AHL25(3)
-----RAP2.3(1)                             <---------REM1(1)           <---------AHL25(2)
--->DEAR3(1)                               ----------->HVH21           --------->AHL25(1)
----DEAR3(1)                             <---------ANAC46 --------->At4g35610    ------->GAMYB
-->ATERF1(1)                             <---------At4g35610           --------->AHL25(2)
--ATERF1(1)   --------->At5g28300        --------->At4g35610           <---------AHL20(2)
-------->ATERF1(1) --------->ALFIN1   <---------MYB52(1)  <---------At4g35610  -------->P      -----
>ETT(2)     <---------ANAC46        <---------TGA1a--------->MYB59     --------->AHL20(2)    <------
------NtERF2<---------DEAR3(1)      <---------ANAC58<------MYB46(1)  --------->WOX13(2) --------->LBD16
-->HVH21 ----------->HVH21          <---------O2  <-------TEIL       <---------WOX13(2)<---------ATERF1(1)
-DEAR3(1)----------->TGA1           <---------ANAC58<---------DEAR3(2) <---------AHL20(1)   <-------
----->RAP2.3(1) <---------MYB46(3)  <---------ANAC46<------MYB83 --------->RVE1(2) <---------ALFIN1
gcgacggcgacggtgacggtgagtgaggcagtgagagagtcgtgaggtgaaggttcggttcctctgaaaatcaatttaattcaaccccgcccgcgtcttt  2838900
<- Previous    Next ->

AGI:  At1g08840.1   
Description:  EMB2411 (EMBRYO DEFECTIVE 2411); ATP-dependent DNA helicase. similar to DNA-binding protein, putative [Arabidopsis thaliana] (TAIR:AT2G03270.1); similar to hypothetical protein OsI_016565 [Oryza sativa (indica cultivar-group)] (GB:EAY95332.1); similar to hypothetical protein OsJ_015276 [Oryza sativa (japonica cultivar-group)] (GB:EAZ31793.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO70429.1); contains InterPro domain DNA helicase, UvrD/REP type; (InterPro:IPR000212); contains InterPro domain DNA replication factor Dna2 (InterPro:IPR014808)
Range:  from: 2829582    to: 2838372    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.