Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                         --------->ANAC46            --------->ETT(2)
                         --------->ANAC58      --------->GLK1(2)                ------>MYB83
       --------->YAB1    --------->ANAC58      <-----------ARR10                --------->ANAC58
      <-------TEIL     --------->MYB52(1)      <---------ARR14(2)               ------>MYB46(1)
--------->DOF5.7(1) --------->TOE2(3)          --------->ARR14(2)               --------->ANAC58
-------->DOF2      --------->YAB1              <---------ARR11(2)       --------->At4g35610
----->ANAC58     --------->MYB52(1)            --------->ARR11(2)       <---------At4g35610
----->ANAC58   <---------MYB52(2)              --------->RVE1(2) <---------ANAC46<---------ATHB12
agaaagagattcataaaaactaacataaacggaattgtccagagttgaagtatctgtccacagaggtttctggtgatcagaccaagcatcgataacttct  2164800
              <-----------HVH21                     --------->KAN4(2)                             <-
            --------->At4g35610                 <---------At4g35610                               --
            <---------At4g35610                 <------NtERF2                                   <---
         <-------TEIL                          ------>NtERF2                                    ----
       --------->ARR14(2)                      <---------DEAR3(2)                               ----
       <---------GLK1(2)                     <---------MYB52(1)                                 <---
       --------->GATA12                 --------->GLK1(2)                              <---------ICU4
       <---------GATA12             --------->YAB1 --------->KAN1                      -------------
       <---------ARR14(2)       ---------->ID1<---------DEAR3(1)                       --------->YAB5
<---------MYB46(3)          <----------DOF2 <-----------HVH21                          -------------
tgatggttcagattcagcttcagacccaagtctttgtcttcataatccgtcggcttattctcccaaaacccaaaacttgagccttcttgatcagtactcg  2164900
       <<<<<<<<<TBF1                               <---------O2
   <-----------GT1                                 --------->ANAC46
----------DOF2                                     --------->O2
--------DOF5.7(1)                                  =================MYC_MYB
---->ZmHOX2a(2)                             --------->KAN1           <---------At4g35610
------GATA12                                --------->GLK1(1)        --------->At4g35610
----->ARR11(3)                              <---------GLK1(1)  ---------->DOF2
----->GATA12      <---------ARR11(3)     --------->LBD16     <---------MYB52(1)     --------->YAB1
------ARR11(3)    --------->GATA12      --------->HSFB2a(2) <-------GAMYB  --------->WOX13(2)
-->AtSPL8        --------->REM1(1)      <---------HSFB2a(2)--------->MYB52(2)  <---------YAB1   ----
-->AtSPL3      <---------ALFIN1---------->ID1    <---------ALFIN1 <---------At4g35610    <---------bZIP60(1)
atcttttttcttcttcccctacatcttcatcttcgtcttcttcccagaaatcccacgtgagttcgttagagcagcttaaattgtcaatggtgatgtcgaa  2165000
                      <--------ATHB1                                                            <<<<
                     <---------YAB5                                                          <<<<<<<
                     <---------YAB1                                                       <<<<<<<<<TBF1
                     <---------KAN1                          <---------TOE2(3)    ------>ZmHOX2a(2)
         <---------ATHB12  <-----------RAV1(1)               <---------TOE1(3)  --------->ARR11(3)
   --------->HSFB2a(2)--------->ATHB12                       <---------TOE2(2)  <---------RVE1(2)
   <---------HSFB2a(2)--------->YAB5                <---------WOX13(1)---------->DOF2  <<<<<<<<<TBF1
----->KAN1           --------->ICU4          <---------YAB1  <---------TOE1(2)  <---------ARR11(3)
aatgctctcgaaatcatctatagaatgattgtgttggtctcgagagtgaccattgatggactcgaaggttgaagaaagtagatgatcttcttcttcttct  2165100
                                                                          --------->AHL12(2)    <---
                                                                          <---------AHL25(2)    <---
                                                                          <---------AHL12(3)   -----
                              --------->ARR11(3)                         <---------AHL20(1)    <----
                      <---------ARR11(2)                                 <---------AHL12(1)    -----
                      ------->TEIL                                       --------->AHL12(1) --------
                      --------->ARR11(2)                                 --------->AHL20(3) --------
                      --------->ARR14(2)                                 <---------AHL25(2) <-------
                      --------->RVE1(2)                                  --------->AHL20(1) <-------
               <----------DOF2<---------ARR11(3)                  --------->ANAC46          --------
              <---------DOF5.7(1)            <-----------GT1    <---------ALFIN1            <-------
 <----------DOF2      <---------ARR14(2)<----------DOF2        --------->ZAT14       <----------DOF2
<---------DOF5.7(1)  <---------CCA1(2) <------------------------ANAC81   <---------ARR11(3)<--------
<<<<<TBF1     --------->TOE2(3)     <---------CCA1(2)         <-----------HVH21   <-----------GT1
<<TBF1  --------->HSFB2a(2)  <---------CCA1(2)    <---------MYB52(1)     --------->AHL25(2)---------
tcttctttcttcggcaacctttgtgtatccatatatctcttatctttttctctgttttgttttcccttcactccaatattttttttttctttgtaaatcc  2165200
---->ANAC46                                                                           <---------TOE1(1)
-----ANAC55(2)                                                                     <---------ARR11(2)
---->ANAC55(2)                 <---------------AGL15                       --------->TGA2(1)
->ARR14(2)             <-------TEIL                                        <---------TGA2(1)
->ARR11(2)  <---------------AGL15                                          <---------REM1(1)
--ARR14(2)  --------------->AGL15                              --------->TOE2(3)   --------->ARR11(2)
--GATA12   ----------------->AGL2                              <----------DOF2------->TEIL
->GATA12   ----------------->AGL3                      <----------DOF2--------->ANAC55(2)
--ARR11(2) <-----------------AGL3    *TSS              --------->TOE2(3)   <---------bZIP60(1)   <--
-GLK1(1)   ====================================MADS_MADS  --------->YAB1   --------->bZIP60(1)  <---
>KAN1--------->ANAC58 --------->CCA1(2)          --------->ALFIN1     <---------ANAC55(2)<---------bZIP60(2)
gtcaccatacgaaaactatatatagatacaaatacaatatttagagagcaaggtgtttctttaatactttaatatgtgatgtaactgatacgatgtggca  2165300
                  <---------KAN1  <------MYB83
                  --------->KAN1<---------WOX13(1)       ----------------->AGL3
                  <---------KAN4(1)                      <---------MYB59
       --------->DAG2      <---------At4g35610          --------->ANAC58
      ---------->DOF2      <---------ZAT2               --------->ANAC58   <---------DOF5.7(1)  ----
-------DOF5.7(1)  --------->KAN4(1)              --------->ZAT2     <---------PCF2    <----------DOF2
------At4g35610  <---------KAN4(2)<------MYB46(1)<---------ZAT2     <---------PCF5    ------>ZmHOX2a(1)
tcttatcccaaaagtgatggaataatctcaagctgattggtttagagagtccagcttggacccaatttgagggacctctcttactggtcctttgcctcta  2165400
                          <----------DOF2             <------------CBF               --------->AHL12(3)
                         <---------DOF5.7(1)         --------->ATHB12                <---------AHL12(3)
                    <-----------GT1                 <---------YAB5                   --------->AHL20(3)
                 <---------DOF5.7(1)               <-----------TGA1           --------->ZAT6
                <---------DOF5.7(1)                <-----------HVH21        --------->YAB1
                <---------DAG2                    <---------ANAC58  --------->DOF5.7(1)
                <----------DOF2    ---------->DOF2<---------ANAC58---------->DOF2    <---------AHL20(3)
---->P    <-----------GT1<---------ICU4        ------>ZmHOX2a(1) <------ZmHOX2a(1)  --------->AHL20(2)
accagagaccatttagccacttttttcatctttatactaatagccgagtcctagcgtcattggggctaggaaagagctataacagtataaaatttccctg  2165500
                               --------->RVE1(2)                                        --------->RAP2.6(2)
                               --------->ARR11(3)              --------->ARR11(3)      <xxxxxxxxxxxx
                 <---------ANAC46                      <---------GLK1(2)               <xxxxxxxxxxxx
                 <---------ANAC58     <---------WOX13(2)      --------->REM1(1)       --------->At4g35610
                 <---------ANAC58     --------->WOX13(2)--------->GLK1(2)    <------ZmHOX2a(1)
        --------->GLK1(1)      <---------ARR11(3)    ----------->ARR10    xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
<<<<<<<<<TBF1  *TSS       ---------->DOF2          <---------KAN1        --------->DOF5.7(1)<-------
ttcttcttcagaattcattttcttgtattcaaagtatcttaagttaagaagagaataagattcttacatcttgatgaagaggaatgggaagccgaaatct  2165600
                     <---------ATHB12                                       ------>ZmHOX2a(1)
                     --------->ICU4                                         xxxxxxxxxxxxxxxxxxxx>smallRNA(l2)
                    --------->WOX13(2)                                   xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                    <---------WOX13(2)                                   xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                --------->ANAC58                                   xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                --------->ANAC58                                   <----------DOF2
             <------NtERF2                                        <---------DOF5.7(1)
             --------->ATERF1(1)                      =============================HOX2a_HOX2a -----
            <-----------HVH21                         ------>ZmHOX2a(2)  xxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
            <-----------TGA1                        <---------ARR11(2)   xxxxxxxxxxxxxxxxxxxx>smallRNA(s2)
            <---------ATERF1(1)                     <---------RVE1(2)    xxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
->RVE1(2)  <---------bZIP60(1)                      --------->GATA12     XXXXXXXXXXXXXXXXXXXX>MIR847
->GATA12   --------->bZIP60(1)          --------->ARR11(3)       <xxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
>GLK1(1)   <---------ANAC58             --------->RVE1(2)       ------>NtERF2<---------DOF5.7(1)<---
xxxxxxxxxsmallRNA(si3)  <---------YAB1  <---------ARR11(3)------->TEIL  --------->ANAC46<---------REM1(1)
xxxxxxxxxsmallRNA(le3)--------->YAB1   --------->GLK1(1) <---------CCA1(2) xxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
--GATA12   <---------ANAC58     <--------P          <---------GATA12  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(l2)
aaactgaaacagaggcgtcacccaattatcaattggtaagtgatatctatgtttcgatctgtatctcggcctttcactcctcttcttcttgatgtaagaa  2165700
<- Previous    Next ->

AGI:  At1g07050.1   
Description:  CONSTANS-like protein-related. similar to CIL [Arabidopsis thaliana] (TAIR:AT4G25990.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO21391.1); contains InterPro domain CCT (InterPro:IPR010402)
Range:  from: 2164187    to: 2165238    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g07051.1   
Description:  MIR847a; miRNA
Range:  from: 2165516    to: 2165745    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.