Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                   -
                                                                                                 <--
                                                                                 --------->KAN1  <--
                                                                                <---------ARR11(3)==
                                                                            ---------->DOF2    -----
              <---------At4g35610            ---------->DOF2                ========================
        <----------DOF2                --------->ZAT6                 <----------DOF2       ------>ZmHOX2a(1)
       <---------DOF5.7(1)          <---------KAN1                    ==============================
-------->ZAT2 --------->At4g35610<------NtERF2                       <---------DOF5.7(1)    --------
-------->At4g35610            <------ZmHOX2a(1)  ----------->RAV1(1)--------->At4g35610   --------->SPL7(1)
---------At4g35610         <-----------RAV1(2)  --------->MYB46(3)  --------->ZAT2      <-----------HVH21
------->GLK1(2)           XXXXXXXXXXXXXXXXXXXX>MIR390A/B       --------->ZAT6   --------->ARR11(3)--
 
gaagctgagccctttgcagctctataagcttcaggaggcataacaccataaaccacagagacattaacaccagctttctcaaagacattcccgtcctgca  870800
               <---------ATERF1(1)
              ------->GAMYB
              --------->DEAR3(1)
              --------->ANAC58
              --------->RAP2.6(2)
              --------->DREB2C(2)
      --------->KAN1
      --------->YAB5--------->AtMYB61
 =====================MYC_MYB
 --------->ANAC46 <---------ATERF1(1)
 --------->ANAC58--------->DEAR3(1)
 --------->ANAC58<---------ALFIN1
 --------->TGA1a--------->ERF1
-------->ANAC46--------->ABI4(1)
-------MYB52(2)------>NtERF2
-------ALFIN1 --------->ANAC58               <----------DOF2
===========MYC_MYB------>NtERF2        <---------ARR11(3)
------>RAV1(1)--------->ANAC46      ------>MYB46(1)
===========bZIP_DOF <---------ALFIN1------>MYB83
===========bZIP_DOF--------->MYB46(3)  --------->ARR11(3)  --------->DEAR3(1)              <<<<<<<<<TAC1
->AtLEC2      --------->DEAR4(1)  --------->AtMYB61     <------ZmHOX2a(1)   <---------WOX13(2) <----
----->GAMYB  --------->MYB46(3)   <---------MYB59   --------->TOE1(2)       --------->WOX13(2) <----
 
acacacgactgattccaccgccaccaccaggtcgagaccaaacatcttctttaaacttaggaccgccttctatagcttcaattgcatcacaaacactgtc  870900
                                                                       <---------ARR14(2)
                                                                       --------->RVE1(2)
                                                                       --------->ARR14(2)
                                                                       --------->GLK1(2)
                                                                   --------->YAB1
                                                                  --------->At4g35610
                                                                  <---------At4g35610
                                                               --------->TGA2(2)
                                                              <-----------TGA1
                                                             ===============================bZIP_DOF
                                                             --------->bZIP60(1)
                                                             --------->ANAC58
                                                             --------->TGA1a
                                                             <---------O2
                                                             --------->O2
                                                             >>>>>>>>>>HY5
                                                             <---------TGA1a
                                                             --------->TGA2(1)
                                                             <---------bZIP60(2)
                                                             --------->bZIP60(2)
                                                             <---------bZIP60(1)
                                                             <---------TGA2(1)
                                                             ===============================bZIP_DOF
                                                             <---------ANAC55(2)
                                                             <---------ANAC46
                  <---------HSFB2a(2)                        --------->ANAC58
          <---------YAB5                      >>>>>>>>>TBF1  --------->ANAC55(2)
          <---------ATHB12                 >>>>>>>>>TBF1    ----------->STF1                 <------
          <---------YAB1                >>>>>>>>>TBF1       <-----------STF1            --------->DOF5.7(1)
  --------->DEAR3(1)              --------->ANAC58        ----------->HVH21           ---------->DOF2
<---------At4g35610               --------->ANAC58        ----------->TGA1       ---------->DOF2
--------->At4g35610             --------->MYB52(1)      <---------ANAC58        <------ZmHOX2a(1)
-----ANAC58--------->YAB1      ----------->HVH21        <---------ANAC58      <---------TOE2(3)
-----ANAC58<---------ICU4      ----------->TGA1   --------->DOF5.7(1) <---------GLK1(2)--------->DOF5.7(1)
 
ttgagcagccctaatcatagtctcgaaacgagccctgacggaagaagaagaagaagatggagtgacgtcatcagaatccctaaggaaagtaaagggtcgt  871000
                                                                            <---------KAN1
        <---------HSFC1(2)                                                 --------->GATA12
        --------->HSFC1(2)                                                 --------->RVE1(2)
        <---------HSFB2a(1)                                                --------->GLK1(2)
        --------->HSFB2a(1)                                                <---------GATA12
       --------->ARR14(2)                                    --------->ATHB12
    --------->HSFB2a(2)                                     <---------YAB1 <---------ARR11(2)
    <---------HSFB2a(2)                           <------MYB83 <---------WOX13(1)
   <---------LBD16                                ----------->GT1          --------->ARR14(2)
   <---------ANAC46 <---------WOX13(2)            <------MYB46(1)          <---------ARR14(2)
  <---------LBD16   --------->WOX13(2)           <---------TOE2(3)        <---------GLK1(2)
---MYB46(3)  <----------DOF2                     --------->MYB59 ----------->HVH21 <---------ZAT14
 
tcagtttcgggaacttctttctcaattgagactgaacatcgcaaggcgagattaggtttatttctgattggacgggagaatctgagagtagagggattgg  871100
                                                                                         <---------RVE1(2)
                                                                               ------>ZmHOX2a(2)
                                                                             --------->GATA12
           --------->YAB5                                                    <---------RVE1(2)  <---
     --------->YAB5               --------->TOE1(2)                          <---------GATA12   ----
  --------->YAB1               ---------->DOF2                         --------->ICU4    <---------GATA12
  --------->YAB5         --------->DOF5.7(1)                      --------->ANAC58       --------->GATA12
  <---------ICU4        --------->DOF5.7(1)     <------ZmHOX2a(1) --------->ANAC58  <---------KAN1
 <---------KAN1       ---------->DOF2     --------->DOF5.7(1)   <---------At4g35610--------->ARR14(2)
 --------->ICU4    <------ZmHOX2a(1)  <------ZmHOX2a(1)         --------->At4g35610<---------ARR14(2)
 
gagaataatgaagacgatgagaggagaaaggagcgaaagtaggagaagagaggagagtcgacgagtgagaagccatgtttgatccgaatttggatttgat  871200
                                                                                --------->WOX13(2)
                                                                -------->ZAP1   <---------WOX13(2)
                                --------->YAB5                 <---------At5g28300     --------->At4g35610
                                --------->YAB1                <---------WRKY18(1)      <---------At4g35610
             --------->ICU4 <---------AHL20(2)                <-----------GT1 <---------AHL20(2)
             <---------YAB1--------->AHL20(2)            <---------RVE1(2)   --------->AHL25(3)
           --------->YAB5 --------->AHL12(2)           <---------ATHB12    <---------DOF5.7(1)
           *TSS         <---------RVE1(1)            <---------At4g35610  <----------DOF2
   >>>>>>>>>TBF1       <---------RVE1(2)           <---------ZAT14       <---------DOF5.7(1)
------At4g35610        <---------ARR11(3)          --------->ZAT18   <---------DOF5.7(1)         ---
----->At4g35610        --------->ARR11(3)        <---------SPL7(1)  <----------DOF2<-----------GT1
 
gctgaagaagaagatgatgatggagagatattaaatgataagaagtcttcgtcgtccactgattttgaccgctcttcctttttatttaacagctcaaggt  871300
                                                                                         --------->WOX13(2)
                                                                                  <---------ANAC46
                                                                                  <---------RAP2.6(2)
                                                                                  <---------ANAC58
                                                                                  <---------ANAC58
                                                                            <---------YAB1
                                                                           <---------AHL20(2)
                                                                           --------->AHL25(1)
                                                                           --------->AHL20(2)
                                                           ------>MYB46(1) <---------AHL25(3)
                                                         --------->AtMYB61 <---------AHL25(1)
                                                   --------->RAP2.6(2)     --------->AHL12(3)
                                                   --------->ANAC46        <---------AHL12(3)
                                           <---------AHL25(1)              <---------AHL25(2)     --
                                           <---------AHL12(3)              --------->AHL25(2)     <-
                                           --------->AHL12(1)             --------->AHL20(2) <------MYB83
                                           --------->AHL25(1)             <---------AHL25(3) <------MYB46(1)
                                           <---------AHL12(1)       --------->ANAC58     <---------WOX13(2)
                                           <---------AHL25(3)       --------->ANAC58   --------->AHL25(3)
                                           --------->ATHB51------>MYB83 <---------WOX13(2)  --------
                                           <---------AHL20(2)       --------->ANAC46 <----------DOF2
                                           --------->AHL20(2)       --------->ANAC55(1)<---------AHL25(1)
                                          <---------AHL12(1)        --------->ANAC55(2)--------->AHL25(1)
          --------->ARR11(2)              --------->AHL12(1)        <---------ANAC55(2)<---------AHL20(2)
          <---------ARR11(2)              <---------YAB5 <---------MYB59--------->WOX13(2)----------
------->DOF2                              --------->AHL25(3)   --------->ANAC46  <---------LBD16 <--
 
aaaagaaaacacagttccagtcttctcagactaaaccacttctgaattatttagccgaaaccaaaccagacacgaaattaaaattgcggtttaatttggt  871400
               --------->ANAC58
      --------->ARR14(3)
      <---------RVE1(2)
      --------->ARR14(2)                                                               <---------ZAT18
      <---------ARR14(2)                                                             --------->ANAC58
      <---------ARR11(3)                                                             --------->ANAC46
      --------->ARR11(3)                             ----------------->AGL1          --------->ANAC58
      <---------ARR14(3)                             <-----------------AGL1         <---------LBD16
    ----------->ARR10                            <---------WOX13(1)     ----------------------->TaNAC69(2)
--------->DEAR3(2)                              --------->WOX13(2)     --------->YAB5--------->ANAC55(2)
------->ARR11(2)                         ------->GAMYB   --------->WOX13(2)         --------->RAP2.6(3)
--------ARR11(2)            --------->KAN1      <---------WOX13(2)     --------->ATHB12--------->ZAT18
->MYB59     <---------RVE1(2)         --------->MYB52(1) <---------WOX13(2)         <---------At5g28300
----------->WRI1          <---------DOF5.7(1)<----------DOF2--------->MYB59      <----------DOF2
-------SPL7(1) --------->ANAC58  ------>ZmHOX2a(1)  ----------------->AGL1   <---------LBD16
 
cgaaccgaagatattgatacacaataggctcttatccttcttaacgggcttaattgcccaaattaggcccaaaacgattagccggtttacggcactatgc  871500
                                  <----------DOF2
                               --------->ARR11(3)
                               <---------ARR11(3)
                             <---------AHL12(1)
                             <---------ARR11(3)                                               ------
                             --------->AHL20(1)                                          --------->ARR14(2)
                             --------->AHL12(1)                                          <---------ARR14(2)
                             <---------AHL20(1)                                          --------->ARR11(2)
                             <---------AHL20(2)                                          <---------ARR11(2)
                             <---------AHL25(3)    <---------KAN1                    <-------TEIL
                   <-----------HVH21              --------->GATA12                 <---------GLK1(2)
               <---------ICU4<---------AHL25(2)   --------->ARR14(2)               --------->ARR11(1)
               --------->YAB1--------->ARR11(3)   --------->GLK1(2)                <---------GATA12<
              <---------ATHB12<---------CCA1(2)   <---------ARR14(2)               <---------RVE1(2)
       ----------->GT1 <---------ANAC55(2)       <---------GLK1(2)                --------->KAN1   -
    <---------ANAC46   ----------->GT1<<<<<<<<<GATA-1   --------->YAB1       <---------YAB1  ------>ZmHOX2a(1)
   <---------RVE1(2)   --------->ANAC55(2)  --------->TOE2(3)        ---------->DOF2--------->ARR14(1)
 
tattttgatgtggataaatcatggtcatgtaatatatctttatctatcgttagaatctgtgataaacaaaacaaaagtgtattatagattcgaatcctat  871600
   --------->AHL25(3)
   <---------YAB1
  <---------AHL20(3)
  --------->AHL25(2)
  --------->AHL12(2)
  <---------AHL12(2)
  --------->AHL20(3)
  <---------AHL12(3)
  <---------AHL25(2)
  --------->AHL12(3)                                                                       ---------
 --------->ATHB51                                                                        <------MYB83
 <---------ICU4                                                                        --------->ALFIN1
 --------->YAB1                                                                        <---------MYB52(1)
 <---------AHL20(2)                                                                    <--------P
 <---------AHL25(3)                                                              --------->ARR11(2)
 --------->AHL12(1)                                                              --------->GLK1(2)
 <--------HAHB4                                                                  --------->ARR14(2)
 -------->ATHB1                                                                  --------->GATA12
 -------->HAHB4                                                       ------>NtERF2<---------LBD16
<---------YAB5                                                       ----------->HVH21<---------MYB52(1)
--------->AHL25(3)                        --------->KAN1           --------->At4g35610<-------GAMYB
--------->ICU4                       ------->GAMYB               <---------YAB5  <---------GATA12
<---------ATHB12               <-----------GT1                --------->KAN1     --------->RVE1(2)
<---------ATHB51        <---------GATA12<---------DOF5.7(1)   <---------AHL20(2) <---------ARR14(2)
<---------YAB1<-----------GT1<---------WOX13(2)            ----------->GT1       <---------ARR11(2)
--->RVE1(2)--------->WOX13(2)--------->WOX13(2)     --------------->AGL15       --------->KAN1
---------WOX13(2)  ------>MYB83--------->YAB1       <---------------AGL15       <---------GLK1(1)
-------->WOX13(2)  ------>MYB46(1)  --------->MYB46(3)--------->AHL20(2)  ---------->DOF2<------MYB46(1)
 
ctaattattatttcaaataaccaaatagatgtaattacaaccgtcttattctttccaaaaaatagttaatcgctgacaaaagaaaatccggttgggccca  871700
<- Previous    Next ->

AGI:  At1g03475.1   
Description:  LIN2 (LESION INITIATION 2); coproporphyrinogen oxidase. Identical to Coproporphyrinogen III oxidase, chloroplast precursor (CPX) [Arabidopsis Thaliana] (GB:Q9LR75;GB:Q546I5;GB:Q94JR5); similar to HEMF2, coproporphyrinogen oxidase [Arabidopsis thaliana] (TAIR:AT4G03205.2); similar to Coproporphyrinogen III oxidase, chloroplast precursor (Coproporphyrinogenase) (Coprogen oxidase) (GB:P35055); contains InterPro domain Coproporphyrinogen III oxidase; (InterPro:IPR001260)
Range:  from: 869051    to: 871212    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.