Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
         <---------GATA12                                                                     ------
         --------->GATA12                                                                     <-----
         ------->TEIL                                                                         ------
        <---------GLK1(2)                                                                     <-----
    --------->At4g35610                  ----------->RAV1(2)                                <-------
    --------->LBD16                  <---------ARR11(3)                                 ------>NtERF2
    <---------At4g35610        <---------YAB1                                        <-------PIF5
  --------->MYB46(3)      ----------->RAV1(2)                                        --------->LBD16
<---------ARR11(2)       --------->GLK1(2)      <------NtERF2                        ------->PIF5 --
--------->ARR11(2)       ------->TEIL--------->ARR11(3)                             <---------O2 <--
--------->GATA12        <---------ARR14(2)     ------>NtERF2                        --------->O2 ---
-----WOX13(2)           --------->ARR11(3)    --------->ETT(2)    <---------YAB5   <---------LBD16--
---->WOX13(2)           --------->ARR14(2)    <---------ETT(2)   --------->GLK1(2)<---------ALFIN1--
ttgcatccgctgaatctcggaatagaagaacctgatgagagctcttctggcgacaacttcggcatgagaatcgttcacaatgtccccacggggactcagc  278200
    ------>MYB83                                         --------->RVE1(2)
    ------>MYB46(1)                               <---------ZAT14
  --------->MYB46(3)                          <---------ARR11(2)
--------->PCF2                                --------->ARR11(2)
--->ZAT2 --------->ANAC58                     --------->GATA12 --------->WOX13(2)
----At4g35610                  --------->ANAC58   --------->ZAT14
--->At4g35610                  --------->ZAT6 --------->ARR14(2)
----ZAT2 --------->ANAC58      --------->ANAC58   --------->ZAT18
----RAV1(2) ------->TEIL     --------->MYB52(1)   --------->At4g35610                             --
------->DEAR3(1)       <-----------HVH21      <---------ARR14(2)   --------->At4g35610           ---
-------At4g35610      --------->DEAR3(1)   <---------ANAC58    <---------WOX13(2)          ---------
------>At4g35610      --------->ANAC46     <---------ANAC58  <---------YAB1               ----------
------->MYB46(3)     <------NtERF2         <---------ANAC46  ------>ZmHOX2a(1)         --------->YAB1
--------->HVH21   --------->PCF5        <----------DOF2  <---------ARR11(3)      >>>>>>>>>MYB2 -----
agcgacccactaacgcacttggtccccgtccctaacgctatcactttcgggtctgcacaaaatcctaattagctctaaatcgaaaaccaaaaataaagca  278300
                                             ----------------------->TaNAC69(2)   <---------HSFB2a(2)
 ----------->HVH21                  --------->DOF5.7(1)   --------->ANAC58        --------->HSFB2a(2)
------->DAG2                      ==================================bZIP_DOF    <---------LBD16
------>DOF5.7(1)                  ---------->DOF2--------->At5g28300         <---------DOF5.7(1)
>DAG2    --------->ARR11(3)      <------ZmHOX2a(1)   --------->bZIP60(1)<-----------GT1            -
>DOF2    <---------ARR11(3)--------->CCA1(2) <------ZmHOX2a(1)    <---------TOE2(3)      <----------
----->DOF2          <------ZmHOX2a(1)       ----------->HVH21 ----------->RAV1(2)<---------LBD16 ---
aagagtgacagagaccttgggaaggagaagagacgaggaaagcggagaggacggtgacttcacgtccctgaggttttcccttcttcgggagagacatgta  278400
                                --------->ARR14(2)                              --------->YAB1
                                --------->ARR11(2)                              --------->KAN1
     <-----------GT1          <---------ALFIN1                             <-------TEIL
<---------RAP2.6(3)          --------->LBD16                               <---------YAB5      -----
-------->RAP2.6(2)      <----------DOF2------>ZmHOX2a(1)              <---------MYB52(1)       -----
-------------TaNAC69(2)<---------DOF5.7(1)        --------->YAB5     <---------At4g35610      ------
------>At4g35610<---------RVE1(2)<---------ATHB12<---------YAB1      <-------GAMYB            ------
agccgaaataaccttctctgatactgtctttccccaatcctcctccattgctacgattcccacaaacaagtccgttgattcattcatgctactcaaaaaa  278500
            --------->ANAC58                                     --------->AHL20(2)
            --------->ANAC58                                     <---------AHL20(2)
           <---------LBD16                                       --------->AHL20(1)
         <---------ARR14(2)                                      <---------AHL25(1)
         <---------ARR11(2)                                      --------->AHL25(1)
         --------->ARR11(2)                                      <---------YAB1
        <------ZmHOX2a(1)                                        --------->AHL25(3)
   <-------TEIL                                                  <---------AHL25(2)
 --------->GATA12                                                --------->AHL25(2)
 --------->ARR14(2)                                              <---------AHL12(3)
 <---------GATA12                                                --------->ICU4                  <--
 <---------ARR14(2)                                              --------->AHL12(1)             ----
 <---------ARR11(2)                                              <---------AHL12(1)             ----
 --------->ARR11(2)                                             --------->AHL12(2)            <-----
---->DAG2--------->ARR14(2)                                     <---------AHL25(2)           <------
---->DOF5.7(1)  <---------KAN1                                  --------->AHL20(3)   ------------>CBF
--->DOF5.7(1)--------->LBD16                       ----------->TBP<---------ICU4    <<<<<<<<<<<<<<<<
---->DOF2--------->PCF2----------->GT1   ------>ZmHOX2a(2)      --------->AHL25(2)--------->RVE1(2)
agcagattcaaggacccgcatgaaaatagttataagtttagggatcgttttagtatatatactacaaaattattaaagtaatcaaaatcccaatgggata  278600
                                 --------->O2                              --------->TOE1(2)
                                 <---------O2                              --------->TOE2(2)
                <-----------TGA1 <---------TGA1a                         <---------ATHB12
  =========================================bZIP_DOF                     <---------ARR14(2)
  --------->TOE2(3)          <-----------HVH21                          ------>MYB46(1)        -----
  <----------DOF2<---------MYB52(1)                                     ------>MYB83           -----
-------YAB5     <-----------HVH21--------->TGA1a                     --------->MYB46(3)  <----------
----->ANAC58   <---------ANAC58  --------->ANAC55(2)               <---------ARR11(2)<---------O2
----->ANAC58   <---------ANAC58  --------->ANAC46                <---------MYB59  ------>ZmHOX2a(2)
----KAN1       --------->ANAC46  --------->ANAC58          ==============================HOX2a_HOX2a
---RVE1(2)     --------->ANAC55(2)                         ------>ZmHOX2a(1)------>ZmHOX2a(1)  <----
<LFY          *TSS--------->KAN1 --------->ANAC58    --------->KAN1--------->MYB52(1)--------->O2
agcatctttaactcacttccgtcactcgcttccttcacgtctctctcccaaaattcaaattcctcaggcctaaccaatcctgtgatcgacgtcgtcaaat  278700
                      <---------ANAC58     --------->GLK1(2)
                      <---------ANAC58    <---------GLK1(2)
                      <---------AtLEC2    <---------RVE1(2)
           --------->LBD16--------->ARR11(3)                                                <-------
          <---------ANAC58--------->ARR14(2)                                   --------->GLK1(2)
          --------->ANAC55(2)  <---------DOF5.7(1)                            --------->ARR14(2)
 ---------->DOF2------>ZmHOX2a(2)   ------>ZmHOX2a(1)                         <---------RVE1(2)
---->KAN1 <---------ANAC55(2) ------>ZmHOX2a(1)                               <---------GLK1(2)
---->AHL12(1)   =====================HOX2a_HOX2a                             --------->KAN1 <-------
-HVH21    <---------ANAC58<---------ARR11(3)                          --------->DOF5.7(2)   <-------
-----AHL12(1)   ===========================HOX2a_HOX2a       -------->P ---------->DOF2   <---------KAN1
attcaaaagcagtccgtgatccattgcatgatcctcttcctgtgggattcttactctcatggctaacccagacgttaaagagattctctgcgattgtgtg  278800
                                        --------->AHL20(2)             <---------WOX13(1)--------->ARR14(2)
                                      <---------MYB52(1)             --------->ATHB12    <---------ARR11(2)
               <-----------GT1       <-------GAMYB                  <---------YAB1       <---------GATA12
             <---------AHL12(1)      --------->LBD16            --------->ATHB12         --------->GLK1(2)
--ANAC46     --------->AHL12(1)     ----------->GT1          <---------At4g35610         <---------ARR14(2)
--ANAC58    <---------AHL12(1) <----------DOF2          <---------ANAC58                 --------->RVE1(2)
--ANAC58    <---------KAN1  <-----------GT1             <---------ANAC58                 --------->ARR11(2)
ataaacttggtaagaatttttcattttgttttttcttttccgttaaaattcaatccattgctggagatgatttgattgaatttcagagagagaatccgaa  278900
                                           <------NtERF2   <<<<<<<<<AtERF-4
                                          ------>NtERF2    <<<<<<<<<AtERF-1
                                        <---------LBD16    <---------ATERF1(1)
                                   <---------RVE1(2)       <<<<<<<<<AtERF-5
                                   <---------GLK1(2)      <---------ANAC58
                                   <---------ARR14(2)     <---------RRTF1(2)
                                   <---------ARR11(2)     <---------ANAC58
                                   --------->ARR11(2)     <---------RAP2.6(2)
                             --------->ALFIN1 --------->ARR11(2)
                          --------->ALFIN1<---------ERF1  --------->ATERF1(2)
                          <-----------RAV1(1) <---------ARR11(2)                                   <
                        <---------KAN1<---------DEAR3(1)  <---------RAP2.3(2)                      <
                       --------->GATA12 <---------ABI4(1) <---------RAP2.3(3)                    ---
                       <---------GATA12<---------RAP2.3(1)<---------ATERF1(2)                 <-----
                       <---------RVE1(2)--------->ATERF1(1)<<<<<<<<<AtERF-2             --------->ARR11(3)
                      <-------GAMYB--------->ARR14(2)     <---------DEAR3(1)            <---------ARR11(3)
                  <-----------HVH21--------->GATA12      --------->RAP2.6(3)    <-------------------
-->LBD16         --------->ANAC46  <---------GATA12--------->ZAT18       <-----------HVH21    ------
gaggcgaagggagacggtttacgtcggatgtggtgctggattcggcggcgataggccactggcggctctcaaactgcttcagagagttgaagagcttaac  279000
         <---------ANAC58   <----------DOF2               <-----------RAV1(1)
      ------>ZmHOX2a(1)   ------->TEIL                  <---------KAN1
     --------------------->WRI1                         --------->At4g35610
---------ANAC58       --------->SPL7(1)                 ----------->RAV1(2)
---------ANAC58      --------->MYB52(1)      <----------DOF2
------>ARR11(3)     <---------SPL7(1)       <---------ANAC58 <---------ANAC58
----WOX13(2) <---------ANAC58               <---------ANAC58 <---------ANAC58
----TaNAC69(2)   --------->At4g35610  ------>ZmHOX2a(2) <---------At4g35610     <---------O2
--->WOX13(2) <---------ANAC58   <---------At4g35610    --------->GATA12         --------->O2      <-
tatcttgtccttgagtgcttagccgaacgaactttggctgatcgatggctttctatggcatctggcggtctcggctacgaccctcgtggtatgtttttgg  279100
<- Previous    Next ->

AGI:  At1g01760.1   
Description:  RNA binding / adenosine deaminase. similar to unnamed protein product [Vitis vinifera] (GB:CAO39555.1); contains InterPro domain Adenosine deaminase/editase; (InterPro:IPR002466)
Range:  from: 276266    to: 278448    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g01770.1   
Description:  similar to hypothetical protein [Vitis vinifera] (GB:CAN74802.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO39542.1); similar to hypothetical protein OsI_024980 [Oryza sativa (indica cultivar-group)] (GB:EAZ03748.1); contains InterPro domain Protein of unknown function DUF1446 (InterPro:IPR010839)
Range:  from: 278615    to: 282891    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.