Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                          <---------ANAC58           --------->ZAT14
                          --------->bZIP60(1)        <---------ZAT14
                        <---------DOF5.7(2)        --------->ANAC46
                       ----------->HVH21    <---------ICU4                  <---------DOF5.7(1)
--------YAB1           --------->WRKY12  --------->AtMYB61                  <---------DAG2
----->YAB1      --------->At4g35610   <---------ALFIN1                      <----------DOF2
-----YAB1       <---------At4g35610  --------->MYB46(3)                    <---------DOF5.7(1)  <---
-----YAB5--------->ATHB12 <---------ANAC58  --------->YAB1              <---------ZAT18---------->DOF2
cataagtgaaaatgtttggagcagagttgacgtcctcatcaccaccatcatcacactgaacaatacaatgagcaatgcgcttttctctcacaaagccaat  71700
                       --------->CCA1(2)              --------->ARR11(2)
                    <---------TOE2(3)      --------->ANAC58
               ------>MYB46(1)             --------->ANAC58
               ------>MYB83                --------->ANAC46--------->ANAC46           <---------TOE2(3)
          <-----------GT1             <---------GATA12<---------ARR11(2)              <---------TOE1(3)
------ARR11(3) --------->RVE1(2)----------->GT1--------->DOF5.7(1)       --------->GATA12
ttcttcaacaatttcacctatctaagatagagaagaagataaatccaagtaagagtgtttacacaaaattgaactaaatcgaccaatttaaggttatcta  71800
                                      --------->AHL12(1)               --------->KAN1
                                      --------->AHL25(2)          --------->ANAC58
                                     <---------AHL12(2)           --------->ANAC58
           --------->ICU4            --------->AHL12(2)           --------->ANAC46
    <---------ICU4             --------->At5g28300            --------->YAB1                  ------
    --------->YAB1---------->ID1     --------->AHL12(3)     ------->TEIL<---------GATA12 --------->KAN1
   <---------ATHB12           ----------->GT1               --------->RVE1(2)     --------->DOF5.7(1)
  <---------WOX13(2)   --------->WOX13(2)                <---------ANAC55(2)    ---------->DOF2    -
  --------->WOX13(2)   <---------WOX13(2)                --------->ANAC55(2)   <---------KAN1 <-----
 --------->WOX13(1)  <---------YAB1  <---------AHL12(3) <---------TOE2(3)   --------->LBD16   <-----
agaccaattaagacataatttgttctaattacacagtaaaaaatatcaaattgttctctaacgtatcacaagcgacatccgagtaaagactaaaattcga  71900
   <---------AHL12(1)           <---------ANAC58
   --------->AHL12(3)           <---------ANAC58                                                <---
   --------->AHL12(1)          <---------At4g35610                                             <----
   --------->AHL25(1)          <---------MYB46(3)                                              -----
   <---------AHL25(1)          --------->At4g35610                                             <----
   <---------AHL12(3)       <---------ANAC58                                                   -----
   <---------AHL20(2)       <---------ANAC58                                                   -----
   --------->AHL25(3)     --------->DOF5.7(1)                                      <------ZmHOX2a(2)
  <---------AHL12(2)     --------->DOF5.7(1)                                      --------->ARR11(3)
  --------->AHL12(2)    --------->DOF5.7(1)                                       <---------ARR11(3)
 <---------AHL12(2)     --------->DAG2                                           <---------GLK1(1)
--->HSFB2a(2)          ---------->DOF2                                           --------->At4g35610
-------->AHL20(2)    <---------HSFB2a(2)                                         <---------At4g35610
----HSFC1(1)         --------->HSFB2a(2)            <------ZmHOX2a(1)   ---------->DOF2       <-----
----HSFB2a(2)        <---------------AGL15<------ZmHOX2a(1)  <---------ARR11(3)  --------->GLK1(1)
gaaaaaataaattaaaggtttcttctaaaaggggtgcttacataaggactcttgaggagagcgatatcatcttcatcaagcgggagatcactcaccattt  72000
    <---------GATA12                                 --------->MYB52(1)
    <---------ARR14(2)                            --------->TOE2(3)
    --------->ARR14(2)                         <---------GLK1(1)
   <---------At4g35610   --------->KAN1        --------->GLK1(1)                           <------MYB83
   --------->KAN1 --------->CCA1(2)           --------->GATA12                            --------->MYB59
------AHL12(2)   --------->ARR11(3)     <---------ANAC58                            <---------At5g28300
-----AHL20(2)    <---------ARR11(3)     <---------ANAC55(2)            <---------HSFC1(2) <---------AtMYB61
---->AHL12(3)    --------->GATA12       <---------ANAC55(1)        --------->DOF5.7(1)  <---------MYB52(1)
-----AHL25(2)    <---------GATA12       --------->ANAC55(2)      ---------->DOF2    <---------DOF5.7(2)
---->AHL25(2)    --------->ARR14(2)     <---------ANAC46    --------->YAB1         <-----------GT1
---->AHL25(1)    <---------ARR14(2)     <---------ANAC58   <---------KAN1      ------->TEIL<------MYB46(1)
----DOF5.7(1)  ----------->ARR10     <---------ARR11(2) --------->YAB5 --------->HSFC1(2)<---------MYB55(1)
tttttcagattccgagtgaagatttgagaaattcgaagggtttacgtgagatttcttaacgaataagaaaaagaagctactgtatgttaccgtttggtct  72100
                       <---------HSFB2a(1)                                        <----------DOF2
                       <---------HSFC1(2)                               ------------>CBF
                       --------->HSFC1(2)                            <----------DOF2  <---------HSFB2a(2)
                <---------ARR14(2)                             <---------------AtSPL8 --------->HSFB2a(2)
                <---------ARR11(2)                       --------------->AGL15 ------->TEIL
             <---------TOE1(3)       *TSS                <---------------AGL15 <-----------GT1
             <---------TOE2(3) <---------KAN1            ------------>CBF   ----------->GT1
ctctgtaagtgtgtctgaggtttcgaaatttcgaatttaggcgaagaaggaagaaactgactcaatgtagtactttgcaatgtaactttctcgatggtcc  72200
                                    <-----------GT1    --------->RVE1(2)
                                  <---------DOF5.7(1)--------->ARR11(3)               <---------ANAC58
                                 <---------DOF5.7(1) --------->AHL25(2)            <--------P      -
                                <---------DOF5.7(1)  <---------AHL25(3)         <---------TOE2(3)  -
                        --------->ARR14(2)           <---------ARR11(3)   <------MYB46(1)          -
             <---------DOF5.7(1)------>ZmHOX2a(1)    --------->AHL20(1)   <------MYB83<---------ANAC46
         <---------HSFC1(2)     <----------DOF2     <---------KAN1       --------->MYB59           <
         --------->HSFC1(2)    <---------DOF5.7(1)  --------->AHL20(2)--------->WOX13(2)           -
       <---------ARR11(2)    ---------->ID1         --------->AHL12(3)<---------WOX13(2) <-------GAMYB
       --------->ARR11(2)<---------KAN1  <------------CBF         <-----------------AG<---------ANAC58
atgggccttagaaccgtcttaggcccaaatatgtccttttttcccattggcccaaatatatccaaaactttctaatttggttagaggttgctcgttgctg  72300
 --------->WOX13(2)                                                                                <
 <---------AHL12(2)                                                                                -
-------->ICU4                                                                              ---------
-------->AHL25(3)                                                                          <--------
-------->AHL25(1)                     *TSS                                            --------->GATA12
---------AHL20(2)                 ---------->DOF2                                  --------->AHL20(2)
-------->AHL20(2)  <---------ANAC46 <----------ID1                      <---------KAN1--------->RVE1(2)
tattaattaatgttttatgttttcgtttagagttttgtaaagacaaattagagagagagagagagagacagaggcatttttggtcataaaatccacacag  72400
                             --------->AHL25(1)                                       <---------ANAC58
                             <---------AHL20(3)                                     ------>ZmHOX2a(1)
                             --------->AHL25(2)                                     ================
                             --------->AHL20(3)                              --------->ATHB12  -----
                             --------->AHL20(1)                              --------->YAB1  -------
                             <---------AHL25(3)                      <---------ANAC58 <---------ANAC58
                            --------->AHL25(3)                       <---------ANAC58 <---------ANAC46
                       --------->ANAC58                 --------->AHL12(3)   <--------HAHB4  <------
                  <---------ARR11(2)                    <---------AHL12(3)   <---------ICU4  <------
  --------->ARR11(2)   --------->ANAC46                <---------AHL20(1)   --------->ICU4   -------
  <---------ARR11(2)   --------->ANAC58             --------->YAB1   <---------ANAC46<---------TOE1(2)
<---------MYB46(3)--------->GATA12                  --------->AHL20(2)      <---------YAB5   -------
--------->MYB55(2)--------->RVE1(2)    --------->ARR14(2)       --------->CCA1(2)  --------->TOE2(2)
---------AtMYB61  <---------GATA12     <---------ARR14(2)      <---------RVE1(2)  <---------ANAC58
-------->ALFIN1   --------->ARR11(2)   --------->ARR11(2)      --------->ARR11(3) <---------ANAC58
>ANAC46           <---------ARR14(2)   <---------GLK1(2)--------->AHL20(2)  <---------ATHB12 <------
-ALFIN1    <-----------RAV1(2)        <------ZmHOX2a(1)--------->AHL20(1) --------->WOX13(1) <------
aggtggttcgacatccaggtgaatccaagtaataaattgcaggattctctctctataatatatatagatatagcttgcaatcatttcctgcgtttggatc  72500
==HOX2a_HOX2a                                                                         <---------At4g35610
->ZmHOX2a(2)                                 --------->WOX13(2)                    --------->ZAT2 --
-->ARR11(2)                                 --------->MYB52(2)                     <---------ZAT2---
---GATA12                         <---------WOX13(2)                               <---------At4g35610
---ARR14(2)           <---------LBD16 <---------TOE2(3)                            --------->At4g35610
-->ARR14(2)      <---------DOF5.7(1)  <---------TOE1(3)            --------->DOF5.7(1)--------->ZAT2
-->GATA12        <----------DOF2  --------->WOX13(2)          ----------->GT1     ----------->RAV1(1)
---ARR11(2)  <---------TOE1(2)--------->ANAC58       ---------->DOF2    >>>>>>>>>TBF1----------->RAV1(1)
---RVE1(2)--------->ETT(2)    --------->ANAC58 --------->ALFIN1  ---------->DOF2<-------TEIL  ------
ggtctgggttttgtcgagggttttttggggaagacgaaattagggtttagttggggcaaagtaagtagtaaagaagaagaagatgcagcagcagcagtct  72600
<- Previous    Next ->

AGI:  At1g01150.1   
Description:  DNA binding / zinc ion binding. similar to TRFL10 (TRF-LIKE 10), DNA binding [Arabidopsis thaliana] (TAIR:AT5G03780.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN80644.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO23553.1); contains InterPro domain Homeodomain-related; (InterPro:IPR012287); contains InterPro domain SANT, DNA-binding; (InterPro:IPR001005); contains InterPro domain Homeodomain-like (InterPro:IPR009057); contains InterPro domain Zinc finger, FYVE/PHD-type; (InterPro:IPR011011)
Range:  from: 70115    to: 72138    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g01160.1   
Description:  GIF2 (GRF1-INTERACTING FACTOR 2). similar to GIF3 (GRF1-INTERACTING FACTOR 3) [Arabidopsis thaliana] (TAIR:AT4G00850.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO24305.1); contains InterPro domain SSXT (InterPro:IPR007726)
Range:  from: 72339    to: 74096    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.