Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
               ----------->RAV1(1)          --------->ANAC58
            ----------->RAV1(1)             --------->ANAC58                  ---------->DOF2
         --------->HSFB2a(2)               --------->DOF5.7(1)         <------ZmHOX2a(1)
     <---------DAG2                       ---------->DOF2            <---------TOE1(3)
     <----------DOF2------------------------>ANAC81---------->DOF2   <---------TOE2(3)           ---
------->ZAT18 --------->MYB46(3)       --------->ANAC58          --------->WOX13(2)              <--
--------ZAT18 --------->REM1(1)        --------->ANAC58          <---------WOX13(2)     --------->ATHB12
gtctactactttctgcaacaacaaaacaaaaaaactaaaaccaagaaaagccccaaaagattaccacaaattaaggaaacttaaagcccattgatttcaa  63400
                                                          <---------ARR11(2) <---------AHL25(1)
                     <---------WOX13(1)                 --------->HSFB2a(1) --------->AHL25(3)
                    --------->WOX13(2)                  --------->HSFC1(2)  <---------ATHB12
            ----------->HVH21                           <---------HSFC1(2)  <---------ATHB51  <-----
        --------->ZAT14                              --------->LBD16 --------->At4g35610      ------
        --------->GLK1(1)     ---------->ID1       <---------LBD16  --------->ARR11(3)        ------
        <---------ZAT14<-----------GT1             --------->At4g35610      --------->ICU4----------
        <---------GLK1(1) --------->TOE2(3)    <-----------HVH21    <---------ARR11(3) ---------->DOF2
     ------->GAMYB --------->YAB5         ------->TEIL  <---------HSFB2a(1)--------->WOX13(2) <-----
------>RVE1(2)    <---------YAB1  <---------ANAC58 <---------------------WRI1<---------AHL20(2)-----
-------ARR11(3) <----------DOF2   <---------ANAC58 <---------At4g35610     <---------WOX13(2)<------
catctcaacagagctctgactttgattaaccttgttgtcttgttgaaccttgtcaccggagtttccaaggagagcttcaattatttctttaaaaggaata  63500
                                                                               ----------->HVH21 ---
                                                                               --------->ANAC46  <--
                                                                           --------->YAB1  ---------
                                                                    ------>MYB46(1)   <------ZmHOX2a(2)
                                                                    ------>MYB83 <---------LBD16----
    <----------DOF2                                                 --------->ANAC58  ==============
   <---------DOF5.7(1)   <---------ANAC58                           --------->ANAC46 --------->ARR11(2)
----KAN4(1)           <----------DOF2                               --------->ANAC58 <---------GATA12
--->KAN4(1)          <---------DOF5.7(1)                          --------->DEAR3(1) --------->RVE1(2)
--->KAN1        <----------DOF2                     <----------DOF2--------->ABI4(1) <---------ARR11(2)
->GT1  <------------------------ANAC81       <---------ANAC58     <---------ALFIN1   <---------ARR14(2)
----KAN1 <---------DOF5.7(1)                 <---------ANAC58     --------->AtMYB61  --------->ARR14(2)
---->KAN4(2)   <---------DOF5.7(1)    <----------DOF2            --------->MYB46(3)  --------->GATA12
---KAN4(2)<----------DOF2<---------ANAC58    <---------ANAC46   ------>NtERF2 --------->SPL7(1)<----
atctcttctttctctttctctttctctttcttgttcttgttctttcttccgtctactttccatttgccaccaccccattcatacgacggatccatccacg  63600
--------RAP2.3(1)                                                       ============================
------->RAP2.6(2)                                                       <----------DOF2
---->NtERF2                                                            <---------DOF5.7(1)
-------DEAR3(1)                                                      ------>ZmHOX2a(2)
--->ANAC46                                                         --------->GATA12
----DEAR3(1)               --------->LBD16                         <---------GATA12
--ALFIN1                 <---------LBD16                        <-------TEIL                <-------
==================HOX2a_HOX2a                <---------ANAC58  --------->ARR14(1)           <-------
------NtERF2        --------->O2             <---------ANAC58 --------->ARR14(2)        ------>ZmHOX2a(2)
------>ATERF1(2)  <---------ALFIN1 <------NtERF2              <---------ARR14(2)      --------->GATA12
-------ATERF1(2)------>NtERF2     ------>NtERF2               --------->GATA12        <---------GATA12
---LBD16    --------->ANAC46 <---------ARR11(2)               <---------GATA12<---------MYB52(1)
>MYB46(3)  ------>ZmHOX2a(1) --------->SPL7(1)                <---------GLK1(2)  <---------RVE1(2)--
----->RAP2.6(3)--------->DEAR3(1)--------->DEAR3(1)           --------->ARR11(1)--------->KAN1   <--
==================HOX2a_HOX2a--------->ARR11(2)              --------->KAN1  <-------GAMYB  --------
-----ATERF1(1) --------->ANAC46 --------->DEAR3(2)          ----------->ARR10=======================
gcggcaacaccctcctcgcagccacttctccggatgccgacgctgtttccttgtctgaaaccctagattcgatctctttcggttgattcgatctcgcgta  63700
  --------->GLK1(2)                                                           <---------ZAT14
 --------->GATA12                                                             --------->ZAT14
 <---------GLK1(2)                                      <---------GATA12<---------ARR11(3)
 <---------GATA12                                       <---------ARR14(2)    <---------REM1(2)
 <---------RVE1(2)                                      <---------ARR11(2)--------->YAB5
 <---------ARR14(2)                                ----------->GT1      --------->ARR11(3)
 --------->ARR14(2)                         <---------HSFB2a(2)         --------->GLK1(2)    <xxxxxx
=====================bZIP_DOF               --------->HSFB2a(2)         --------->RVE1(2)--------->GATA12
--ANAC55(2)<---------O2                     <---------ANAC46   --------->MYB46(3)        <---------ARR14(2)
--ANAC46 <---------ZAT14  --------->YAB5   <---------LBD16     <---------ATHB12          ------->TEIL
------->YAB1 --------->ALFIN1     --------->GLK1(2)--------->At4g35610 <---------GLK1(2) <---------GATA12
-------YAB5<---------bZIP60(2)   <---------GLK1(2)--------->ALFIN1--------->ANAC58       --------->ARR14(2)
->ANAC55(2)<---------ANAC46     --------->YAB5   <------ZmHOX2a(1)--------->ANAC58       --------->GLK1(2)
=====================MYC_MYB   <---------YAB1--------->LBD16 --------->WOX13(1)<---------ALFIN1-----
atcagattctggtgaagtgggaacagaaaccattacgattctttcttccggaggaggtgaatcccaatcacccaaaatctctacactctctgaatctgaa  63800
                                                    <---------ANAC58                         <------
                                                    --------->ANAC55(2)                     --------
                                                    <---------ANAC58   --------->YAB5--------->ANAC46
 <-----------GT1                                <----------DOF2<---------RVE1(2)     --------->ANAC58
xxxxxxxxxxsmallRNA(si3)                <----------DOF2        --------->ATHB12       --------->ANAC58
-->TEIL --------->TOE2(3)              <---------DAG2    <---------MYB46(3)       ------->GAMYB   --
cgtttctccattcttaaaaactttggaatgcgaaatttgcgactttatgggctttacgggctgtttgatttgaaagattagacaactcacacaacttatt  63900
    <-----------GT1                                 <---------YAB5
    --------->MYB52(1)         ------>ZmHOX2a(1)    <---------YAB1
  <---------MYB52(2)       <---------ALFIN1         ------------>CBF                          <-----
 <---------WOX13(2)       ------>MYB46(1)       <-----------TGA1                              <-----
 --------->WOX13(2)     --------->AtMYB61       <-----------HVH21<---------ZAT14  <---------DAG2
--------->WOX13(1)      --------->MYB46(3)     --------->ANAC46--------------->AtSPL3         <-----
------CBF<---------AtMYB61------>MYB83    --------->AtMYB61    --------------->AtSPL8        <------
->ATHB12<---------MYB52(1)-------->P     --------->MYB46(3) ----------->HVH21     <----------DOF2
---------->CBF <---------At4g35610     <-----------GT1    --------->ALFIN1   <---------AHL25(3)
gggcaattaacgttggtctgctcaacaccaactcctcactagaaaccactccgtcatcaatgtgtgactgtacatcaaaataaaactttttttttttggt  64000
         ------>ZmHOX2a(2)                   <---------YAB1
        <------ZmHOX2a(2)             <---------AHL25(3)
       <---------GATA12               --------->AHL12(1)
       --------->RVE1(2)              <--------ATHB1
       --------->AGP1                 --------->YAB5
       --------->ARR11(3)             --------->YAB1
       <---------ARR11(3)             <---------AHL12(1)
       <---------ARR11(2)             -------->HAHB4
       <---------ARR14(2)             <---------ICU4
       <---------AGP1--------->YAB1  <---------ATHB51
      <---------CCA1(2)              --------->ICU4
--GAMYB--------->GATA12             --------->AHL12(2)                                <-----------GT1
----ANAC58          <---------TOE2(3)<---------YAB5                     <-----------RAV1(1)
----ANAC58      <---------At4g35610--------->YAB1            <------------CBF    <------------CBF
---MYB46(3)    ------->TEIL     <----------DOF2<------------CBF----------->GT1 <---------YAB5      -
tgcaaacgtagatctatgtagctaagataacctctctttaataattctatcattgtgttttccaaattgttatatatgttgtgtcattgtaacgcgttgc  64100
   <----------ID1                           <---------At4g35610     <---------WOX13(1)
--------->DAG2                  --------->ANAC46                   <---------WOX13(2)
--------->DOF5.7(1)          --------->ZAT14--------->ZAT2         --------->WOX13(2)   <---------WOX13(1)
--------->DOF2           <-----------GT1    --------->At4g35610 <---------MYB59    <----------DOF2
cataaagcgacaacatcgttgcaactttcaactatactcaaatagccagcttgcagagtattttttgcctaattgaattgtttgaactttgatttatagg  64200
                                                   ----------------------->TaNAC69(2)             --
                 --------->YAB5            --------->TOE2(2)       <---------ALFIN1      <---------DOF5.7(1)
              <------ZmHOX2a(1)          -------->P--------->ARR11(3)                   <----------DOF2
            <---------TOE2(3)  <---------RVE1(2)   <---------ARR11(3)          >>>>>>>ZML2<---------
        <---------KAN1    <-----------RAV1(1)  --------->YAB1     <---------ZAT18     ---------->ID1
tttcaaaccgagtttgaggatgatcacatatgtggctattgactaacctatggtgatctacctctatagaccacttctagttctagtttggctcttttgt  64300
<- Previous    Next ->

AGI:  At1g01130.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G47170.1); contains domain CALCIUM/CALMODULIN-DEPENDENT PROTEIN KINASE-RELATED (PTHR22982); contains domain CBL-INTERACTING PROTEIN KINASE-RELATED (PTHR22982:SF45)
Range:  from: 61963    to: 63811    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At1g01140.1   
Description:  CIPK9 (CBL-INTERACTING PROTEIN KINASE 9); kinase. similar to CIPK23 (CBL-INTERACTING PROTEIN KINASE 23), kinase [Arabidopsis thaliana] (TAIR:AT1G30270.2); similar to CIPK23 (CBL-INTERACTING PROTEIN KINASE 23), kinase [Arabidopsis thaliana] (TAIR:AT1G30270.1); similar to CBL-interacting protein kinase 12 [Populus trichocarpa] (GB:ABJ91219.1); contains InterPro domain NAF; (InterPro:IPR004041); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Serine/threon
Range:  from: 64166    to: 67625    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.