Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
        <---------AHL12(1)        <---------AHL20(3)
        <---------AHL25(3)        --------->AHL25(1)
        <---------AHL20(2)     --------->AHL20(2)
        --------->AHL20(2)     --------->AHL20(3)
        <---------AHL25(2)     <---------AHL12(3)
        --------->AHL20(1)     --------->AHL12(3)
        --------->AHL12(1)     <---------AHL20(3)
        <---------AHL20(1)     --------->AHL25(1)
        --------->AHL20(3)     <---------AHL25(3)                                   --------->ANAC58
        <---------AHL25(1)     --------->AHL25(2)                                ----------->HVH21
        --------->AHL25(1)   --------->AHL20(2)              <------ZmHOX2a(1)   ----------->TGA1
        <---------AHL20(3)   --------->AHL25(2)    <------MYB46(1)              <---------MYB52(2)
        --------->AHL25(2)   --------->AHL20(3)    <------MYB83                <---------At4g35610
       --------->AHL20(2)    <---------AHL25(2)   <---------TOE2(3)   --------->LBD16            ---
       --------->AHL25(3)    <---------AHL20(3)   --------->MYB59    --------->LBD16--------->ANAC58
       <---------KAN1  <---------RAP2.6(3)     <---------WOX13(2)  <-----------------AGL1--------->ICU4
     --------->YAB1   <---------ETT(1) --------->AHL20(1)   --------->ZAT18    --------->At4g35610 <
  --------->YAB1      --------->RAP2.6(2)      --------->WOX13(2) -------->P --------->ZAT18 ------>ZmHOX2a(2)
aactataagaataaattgcaaatggccgacaaaataatataataaaatgcaattaggtttgagaggactaacccgagaaggccactgacgaaatgatcga  40500
                                                                        <---------AHL25(2)         <
                                                                        --------->AHL25(2)         <
                                                                        --------->AHL20(3)         <
                                                                      <---------YAB1          <-----
                                                                     --------->AHL20(2)       <-----
                                                                     <---------AHL25(1)      <------
                                                                     --------->AHL25(1)   --------->KAN1
                                                                     <---------AHL25(2)  <---------YAB1
                                                                  <---------WOX13(2)     <---------TOE2(3)
             --------->MYB52(2)                                   --------->WOX13(2) <---------AHL12(2)
          --------->TOE2(3)                        --------->GLK1(2) --------->AHL20(3)  <---------YAB5
        <---------YAB5                        --------->YAB1      --------->TOE2(3)--------->AHL20(1)
      <---------ARR11(2)             <-----------GT1          --------->AHL12(2)   <---------AHL20(1)
------>YAB5<---------MYB52(1)     --------->WOX13(2)  <----------DOF2<---------AHL20(2) <-----------GT1
---------MYB52(1)               ------>ZmHOX2a(1)--------->KAN1 <-------TEIL      --------->AHL12(3)
ccattagcctaaacgttatttgtggtcttgttttcctatttaacaacaatagaaattctttagaaaattcattaaaattatacatatatattaacattcg  40600
                                                ===============HOX2a_HOX2a             ---------->DOF2
---------ANAC58                           --------->RVE1(2)                  --------->ANAC58
---------ANAC46                       <-----------GT1                 <---------DOF5.7(1)--------->DOF5.7(1)
---------ANAC58                 <---------GLK1(2)              --------->RVE1(2)    --------->ANAC58
----ANAC58       <---------ANAC58     --------->ZAT6    <------ZmHOX2a(2)    --------->ANAC58
----ANAC58       <---------AtLEC2   <-----------GT1    --------->GATA12      --------->ANAC46
-TEIL            <---------ANAC58 <---------KAN1------>ZmHOX2a(1)     <---------DAG2--------->ANAC58
tggcttctaaatttctacttgcatgttagaatacagaattttcactatctcctatttcgatcaacatatcaaacctttccaagacataggcaaagggaac  40700
                 --------->KAN1                                                       <---------MYB52(2)
          <---------ARR11(2)                                                          <---------MYB46(2)
      <---------LBD16                                         <---------ARR11(3)      --------->DEAR3(1)
    --------->DOF5.7(1)            --------->YAB5             --------->ARR11(3)      --------->MYB46(3)
   ---------->DOF2                 --------->YAB1     ------>MYB83            --------->ZAT14
  <---------AHL25(1)              <---------ATHB12    ------>MYB46(1)         <-------TEIL
  --------->AHL20(2)      --------->ANAC58           ----------->RAV1(1)      <---------ZAT18
<---------WOX13(2)        --------->ANAC58          --------->AtMYB61         --------->ZAT18
--------->WOX13(2)     <---------RVE1(2)         --------->ANAC46<----------DOF2     --------->ANAC46
caaaattaaagcggaaatagccattcgataagcaccaatgaccatatggttcacaccaacatcaagagctttcttcacaagtgcattcaccgaacccatc  40800
                                  <---------AHL12(2)                     <---------ARR14(2)
                                  --------->AHL12(2)                     --------->RVE1(2)
                                  --------->AHL12(3)                     --------->ARR11(3)
                                  <---------AHL12(3)                     <---------ARR11(1)
                                 <---------AHL12(1)                      <---------ARR11(3)
                                 <---------AHL20(1)                --------->ANAC58
                                 --------->AHL20(1)                --------->ANAC58
                                 --------->AHL12(2)                --------->ANAC46
                                 --------->AHL12(1)          <---------ARR11(3)
                                 --------->AHL20(3)          --------->ARR11(2)
                                 <---------AHL25(2)          <---------ARR11(2)
                                 <---------AHL20(3)          <---------ARR14(2)
                                 --------->ARR11(3)          <-----------ARR10
                --------->YAB5   --------->AHL25(2)          --------->ARR11(3)
             --------->AtMYB61   <---------ARR11(3)          --------->RVE1(2)
       <---------bZIP60(1)      <---------AHL12(1)           --------->ARR14(2)
       --------->bZIP60(1)      --------->AHL12(1)          <---------CCA1(2)
     <-----------GT1       --------->At5g28300              <---------GLK1(1)
    ----------->HVH21     ----------->GT1   --------->ZAT14 <---------KAN1
--------->REM1(1)    ----------->HVH21  <-----------GT1 --------->AtLEC2<---------CCA1(2)      <----
gctacatttgacatcaccatcactatgaccggtgaatatttttctactactctcactccttgcatatctccagccatatctctctctatatgtgagttat  40900
                           >>>>>>>>>>>>>>>>>LFY           <---------HSFC1(2)  --------->DAG2
                        --------->ANAC58                  --------->HSFC1(2)  --------->DOF5.7(1)
                        --------->ANAC58               ---------->DOF2       ---------->DOF2
 <---------ANAC58     --------->KAN1                --------->TOE2(3) <---------AHL20(2)         <--
 <---------ANAC46     --------->CCA1(2)            --------->MYB46(3) --------->YAB1        --------
 <---------ANAC58    <---------RVE1(2)     *TSS   -------->P   ----------------->AGL3    <----------
-----YAB1           --------->CCA1(2)<----------DOF2------->GAMYB   <-----------TBP   ------->TEIL
ttttgtgtgtattacttagagagagataagccccaatgtgctttgagtttggcaaccacaaagcttcccatatttataagaaaagtgtgtatgtgttgtt  41000
                            --------->TOE1(3)      --------->LBD16
                            --------->TOE2(3)    ----------->RAV1(2)
                         <---------DOF5.7(2)     <---------LBD16                   <-------MYC3
                       --------->DOF5.7(2)<---------YAB1                           ------->MYC3
                      --------->TOE1(3)--------->AHL20(3)                          <-------MYC2
                      --------->TOE2(3)--------->AHL12(3)                          ------->MYC2  <--
<----------DOF2     <---------TOE2(3)  <---------AHL20(2)           <-----------ARR10            <--
-------ALFIN1       <---------TOE1(3)  <---------AHL12(3)           --------->ARR11(3)        <-----
->KAN1            ----------->HVH21    <---------AHL20(3)    --------->RVE1(2)    <---------KAN1 ---
-RAV1(1)        <----------DOF2<---------DOF5.7(2) ------>ZmHOX2a(1)<---------ARR11(3) ------->TEIL-
ccactttggacttacttagctttgacgttaacgttaacctatatttttattctcctgaactacttatctaaaatcttactacagcatatgcatttgtttt  41100
            --------->ANAC58         <---------AHL25(3)
         <---------ATHB12            --------->AHL25(1)
        --------->WOX13(2)           <---------AHL20(2)
        <---------WOX13(2)           --------->AHL20(3)
       --------->WOX13(1)            <---------AHL20(3)           ----------->GT1
   ----------->GT1                 --------->AHL12(2)   <---------GLK1(2)
  --------->DAG2                 --------->AHL20(2)     <---------RVE1(2)
 ---------->DOF2                 <---------AHL20(2)     --------->ARR14(2)
-------TOE2(3)                 <----------DOF2          --------->ARR11(3)                        <-
-------WOX13(2)           <---------ALFIN1              <---------ARR14(2)                      ----
----AHL20(2)--------->ANAC58  <---------DOF5.7(1)      <------ZmHOX2a(1)     --------->YAB1    <----
------>WOX13(2)           --------->REM1(1)   --------->ZAT18     --------->TOE2(3)            <----
-------->YAB1            --------->ZAT14   <---------ANAC46       --------->YAB5       <-----------GT1
aatgaaaagttaatcaagcacttcatactacaccctttaattttttatgtgtacaataggattttcaaacgtttaaaatagcataacatattactatatt  41200
                                <------ZmHOX2a(1)                               <---------TOE2(3)
                        <---------ARR11(3)                              --------->AHL20(3)
    --------->RVE1(2)   <---------GLK1(2)                               <---------AHL25(1)
   --------->GLK1(1)   --------->KAN1                   ------>NtERF2   --------->AHL20(2)
   --------->KAN1   <---------AtLEC2 --------->AHL20(2)--------->ANAC58 <---------AHL20(2)    <-----
--------YAB5   <---------DOF5.7(1) <---------WOX13(2)  --------->ANAC46 <---------AHL20(3)    <-----
----->YAB1 --------->KAN1--------->GLK1(2)    <-------TEIL--------->DEAR3(1)   --------->MYB52(1)
-----YAB5 <---------ARR14(2)  <---------TOE1(3)        --------->ANAC58 --------->AHL25(1) <--------
---TEIL   --------->ARR14(2)  <---------TOE2(3)      <---------ALFIN1<---------RVE1(2)  --------->TOE2(3)
catcatatatccaaatactctttgcaagattctaaggaaattacataggtacattaccacgccgaagcatttgattttaatctaacgaattcgttaactt  41300
                        <---------WOX13(2)                      --------->AHL20(2)
                       <---------DOF5.7(2)                      --------->AHL12(3)
                     --------->DOF5.7(2)                      --------->AHL20(2)
                     <---------MYB52(1)                       <---------AHL12(3)
                    --------->TOE2(3)                         <---------AHL20(2)              <-----
                --------->ARR14(2)                          --------->AHL12(3)--------->AHL12(3)
                <---------ARR14(2)                          <---------AHL12(3)<---------AHL12(1)
                --------->ARR11(2)                          <---------AHL20(2)--------->AHL12(1)
                <---------ARR11(2)                   ----------->GT1<---------AHL12(3)   <---------DOF5.7(1)
             <---------ANAC55(2)                --------->MYB46(3)<---------AHL12(3)    <----------DOF2
-----DOF2    --------->ANAC55(2)                <---------ALFIN1<---------AHL12(3)     <---------DOF5.7(1)
----DAG2 <---------WOX13(2)                   --------->ANAC46--------->AHL12(3)  <-----------GT1
-DOF5.7(2) <-----------GT1             <---------TOE2(3)    --------->AHL20(2)<---------AHL20(2)
ttttttttggtgaattacgaattcgttaacttggcatagattaatgttcccacaacctgttatatatatatatatatatatatattttcttctttttttg  41400
<- Previous    Next ->

AGI:  At1g01070.1   
Description:  nodulin MtN21 family protein. similar to nodulin MtN21 family protein [Arabidopsis thaliana] (TAIR:AT1G11460.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO62855.1); contains InterPro domain Protein of unknown function DUF6, transmembrane; (InterPro:IPR000620)
Range:  from: 38752    to: 40944    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.