AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
         <---------AHL20(2)
         <---------AHL12(3)
        <---------AHL25(3)
        --------->AHL25(3)
        --------->AHL20(1)
        <---------AHL12(1)
        --------->AHL12(1)
        <---------AHL20(1)
        --------->ARR11(3)
        <---------ARR11(3)
        --------->AHL20(2)
        --------->AHL25(1)
        --------->AHL25(2)               ----------->GT1
        <---------AHL25(2)             ---------->DOF2
        <---------AHL25(1)         --------->RVE1(2)
        <---------AHL20(3)      <---------AtLEC2
        --------->AHL20(3)  --------->CCA1(2)                                                      <
        <---------AHL20(2) <---------RVE1(2)                                                       <
       --------->AHL25(1)  --------->GATA12                                            <---------ARR11(2)
       --------->AHL12(3)  <---------ARR14(2)                 <-----------GT1       --------->ALFIN1
       --------->AHL12(2)  --------->ARR14(2)            --------->GATA12   --------->MYB52(2)     -
->YAB1 <---------AHL12(3)  <---------GATA12              <---------GATA12 <---------MYB52(1)       <
 
aactcttgaaatatatttgaaatgctaagagatttgcatatcaaaagttaatctagtctagatttatactatacctcgttagtgaaggtgtttccatgag  26806600
            --------->ANAC46
          --------->KAN1
         --------->ZAT14
         <---------ZAT14
         --------->ARR11(2)
         <---------ARR11(2)
         <---------ARR14(2)
         --------->ARR14(2)                         <---------ICU4
 <-------TEIL                                       --------->ATHB12                 ------>ZmHOX2a(1)
--------->CCA1(2)                                  <---------YAB1          --------->HSFB2a(1)
---------ARR11(3)                                  --------->ICU4     <---------HSFB2a(2)       <---
---------ARR11(2)                               ------------>ATHB5    --------->HSFB2a(2)     <-----
-------->ARR14(2)                  <---------GLK1(2)--------->YAB5 ------>ZmHOX2a(1)--------->TOE2(3)
---------ARR14(2)      <---------TOE2(3)   <---------YAB5 <-----------GT1 <---------TOE1(2)<--------
 
aagatacatctgtatactctactactgatgttgtttcagattgttcatcgttccatgattgtaacgagtcctgctcgaacgttgtttcctaaacaatttt  26806700
                      <---------AHL12(3)
                      <---------AHL12(1)
                      <---------AHL25(1)
                      --------->AHL25(2)
                      --------->AHL25(1)
                      --------->AHL12(1)
                      --------->ATHB51
                      <---------ICU4
                      --------->AHL12(3)
                      <---------AHL25(3)
                      --------->AHL20(2)
                      <---------AHL20(2)
                     --------->AHL12(1)
                     <---------AHL20(1)
                     <---------AHL25(1)
                     <---------AHL20(2)
                     --------->AHL20(2)
                     <---------AHL12(1)
                     <---------AHL25(2)
                     --------->AHL25(1)
                     --------->AHL25(2)
                     --------->AHL12(3)
                     --------->AHL25(3)
                    --------->AHL12(2)
                    <---------AHL12(2)
                   <---------AHL12(2)
                   --------->AHL12(2)
                  <---------AHL12(3)
                  <---------AHL20(1)
                  --------->AHL20(1)
                  <---------AHL20(2)
                  <---------AHL25(2)
                  --------->AHL25(3)
                  <---------AHL20(3)
                  <---------AHL25(1)
                  <---------AHL12(1)
                  --------->AHL12(1)                                --------->WOX13(2)
                  --------->AHL25(1)                           ------>MYB83
                  --------->AHL20(2)                         --------->MYB46(3)
                  <---------AHL25(3)                         <---------MYB59
                  --------->AHL25(2)                        --------->ANAC46
                  --------->AHL20(3)                    <---------WOX13(2)
                 <---------AHL20(2)                     --------->WOX13(2)              --------->LBD16
                 --------->AHL20(2)                     <---------AHL12(2)          <---------ARR11(2)
                 --------->AHL25(1)                     --------->AHL12(2)          <---------ARR14(2)
                 --------->AHL12(3)                    --------->YAB5       <-----------RAV1(2)    -
        <---------AHL20(2)                             <---------ICU4<---------YAB5 --------->ARR14(2)
------AtLEC2     --------->AHL25(3)                  <---------RVE1(2)     ------>ZmHOX2a(1)<-------
------GT1        <---------AHL25(1)           <---------RVE1(2)------>MYB46(1)      --------->ARR11(2)
-AHL12(2) --------->RVE1(2)              --------->TOE2(3)<-----------GT1<-----------------AGL1    <
 
catgtctatattatatccaaataaattatttctcttaaaaaaaacattagataatagataattacccaactaattgtcctcagaagggaaccgggctcta  26806800
                                       --------->At4g35610
                                       <---------At4g35610
                                ------>ZmHOX2a(2)                               ------>ZmHOX2a(2)
                              --------->GATA12                                 <------ZmHOX2a(2)
             <-----------HVH21<---------ARR14(2)                              <---------ARR11(3)
     --------->AtMYB61        --------->ARR14(2)                              --------->ARR11(3)
   --------->SPL7(1)          <---------GATA12--------->At4g35610             <---------GATA12
 --------->LBD16              --------->ARR11(2)                              --------->GATA12
 <---------SPL7(1)            <---------AGP1  <---------At4g35610             <---------ARR11(2)
-------------->AtSPL3         <---------ARR11(2)                              --------->ARR11(2)
---DOF2 <---------ALFIN1      <---------RVE1(2)                              --------->KAN1
---------LBD16                --------->ARR11(3) --------->At4g35610 <-----------HVH21
 
ttgccggaccatcaccgttcacatcaagcgttggatctggtgagatgtcatcagcatcaactggtgagtaagtgtcccatagatcccagtcgtctccaaa  26806900
                                                                                              <-----
                                                                                             -------
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             <------
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                                            --------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                                                                            --------
                                                                                            <-------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
                                                                                          --------->AHL12(1)
                             <---------CCA1(2)                                            <---------AHL12(1)
                            <---------MYB52(1)               <----------DOF2              --------->AHL12(2)
                           --------->LBD16             ------>ZmHOX2a(2)                  <---------AHL25(2)
                         <---------LBD16               <-------TEIL                       --------->AHL25(2)
                       --------->ARR14(2)             <------ZmHOX2a(2)          ----------->HVH21
                       --------->ARR11(2)            <---------GATA12           <---------MYB59
                       <---------ARR14(2)            <---------ARR11(2)        <---------ANAC55(2)
                --------->DOF5.7(1)                  --------->ARR11(2)        --------->At4g35610
               ---------->DOF2--------->RVE1(2)      <---------ARR14(2)        --------->ANAC55(2)
          ------->TEIL <---------ARR11(2)            --------->ARR14(2)        ----------->RAV1(2)
     --------->O2  <------ZmHOX2a(1)                 --------->GATA12        <-----------GT1<-------
   ----------->RAV1(1)<---------KAN1            <---------MYB52(1)       --------->AHL20(1)---------
 
tagtagccacatgaagctaaaaggactatccggtatctcagaattgtcttcgtttggatccatacttttggagaaacatattacctgactcaaaattttt  26807000
----AHL12(2)
-->AHL12(3)
-->AHL25(2)
---AHL25(3)
---AHL25(2)
---AHL12(3)
---AHL20(2)
---AHL25(1)
-->AHL25(1)
--AHL25(2)
->AHL20(2)
--AHL20(2)
->AHL25(2)                       --------->WOX13(2)
--AHL12(3)                       <---------WOX13(2)
->AHL12(1)                       <---------AHL12(2)
->AHL12(3)                       --------->AHL12(2)
->AHL25(3)                      --------->YAB5
--AHL12(1)                    <---------RVE1(2)
->AHL25(1)                  ----------->GT1
--AHL25(3)             --------->AHL12(3)
>AHL12(2)              <---------AHL12(3)                                                          <
>AHL12(3)              <-----------TBP                                                       <------
-AHL12(3)              --------->AHL20(2)                                                    -------
-AHL25(2)              <---------AHL25(1)                                                    -------
-AHL12(2)              <---------AHL20(2)                                                 <---------ANAC46
>AHL25(3)              <---------AHL25(3)         <---------YAB1                          <---------ANAC58
>AHL25(2)              --------->AHL25(1)       --------->YAB1                            <---------ANAC58
-AHL12(1)            <-----------TBP     <----------DOF2        --------->ZAT6     --------->ARR14(2)
--AHL25(1)     --------->At4g35610    --------->ZAT6          <-----------GT1      <---------ARR14(2)
>AHL12(1)      <---------At4g35610  <-----------GT1--------->YAB1       --------->AtLEC2 --------->ATHB12
 
tttcaaggggctagattaagctgaatttatatagataattaacactttcaagtatcatcaccatttaactcttccattcaaatgcaaatacttgagtgga  26807100
                                                                                   ---------->DOF2
                                                                                <---------WOX13(2)
                                                                                --------->WOX13(2)
                                                                           --------->At4g35610
                                                                       <---------REM1(1)
                                                                     <------------CBF              <
                                                                   --------->AHL20(3)          -----
                                                                   <---------AHL20(3)          -----
                                                                   --------->AHL25(2)          <----
                                                                   <---------AHL25(2)          -----
                                                                   <---------AHL20(2)         ------
                                                                   <---------AHL12(1)         <-----
                                                                   <---------AHL25(1)        <------
                                                                   <---------AHL25(3)        -------
                                                                   --------->AHL12(1)        -------
                                                                   <---------ARR11(3)        -------
                                                                   --------->ARR11(3)        <------
              --------->YAB1                                       --------->AHL20(2)        -------
     --------->TOE2(3)                                             <---------AHL20(1)       <-------
    <---------ZAT6                                                 --------->AHL20(1)       --------
--------->ARR11(2)                                                --------->AHL20(2)       <--------
<---------ARR14(2)                    <---------------------WRI1  <---------AHL12(3)       <--------
--------->ARR14(2)--------->DAG2    --------->DOF5.7(1)           <---------AHL12(1)       ---------
------ZmHOX2a(1) ---------->DOF2  ---------->DOF2                 --------->AHL12(1)  <----------ID1
---ZAT14   <---------ICU4      <---------AHL12(2)                 --------->AHL12(3)  ----------->GT1
-->ZAT18   <------------CBF  --------->AHL20(2)  ---------->DOF2  <---------AHL25(1) <---------TOE2(3)
-->ZAT14 <---------YAB1  ----------->GT1    <---------YAB1 --------->YAB5  <---------At4g35610<-----
 
caggatagtcttaatattgataaagtaatagaaaaaataaagacgttatgaacaaagaaaaaccactaaatatattgtagctcagttaaaggaaaaatat  26807200
     --------->WOX13(2)
     <---------WOX13(2)
    ------>MYB46(1)
    ------>MYB83
  <---------MYB59
-----------GT1
------>TBP
---->AHL12(3)
-----AHL12(3)
---->AHL20(2)
--->AHL20(1)
----AHL20(1)
---AHL12(3)
-->AHL20(2)                                                                                ---------
-->AHL12(3)                             ------>MYB46(1)                                   --------->DOF5.7(1)
-->AHL12(1)                             ------>MYB83                                      <---------TOE2(3)
---AHL12(1)              <---------AHL20(2)                                              --------->DOF5.7(1)
-->AHL25(1)              <---------ATHB51 <----------DOF2                               --------->DOF5.7(1)
--AHL12(2)             <---------AHL12(2) <---------DOF5.7(1)                          --------->DOF5.7(1)
->AHL12(2)             --------->AHL12(2) <---------DAG2                           ----------->GT1
-AHL12(3)          ----------->GT1     <---------ALFIN1                           <---------TOE1(3)
-AHL20(3)<---------TOE1(3)            ------->GAMYB            ---------->DOF2<----------DOF2
>AHL20(3)<---------TOE2(3)          --------->ANAC46           --------->DOF5.7(1)<---------TOE2(3)
----AHL25(3)       --------->YAB5  <-----------GT1   ------>NtERF2 <------ZmHOX2a(1)<------ZmHOX2a(1)
 
atataccaaattaaggcttaaacgataaataatgcatataacccacttttcagtgcctccatggataaaaggatttagcaactttaaggaaaaaaggttt  26807300
                                                                                      <---------AHL25(2)
                                                                                      <---------AHL20(2)
                                                                                      --------->AHL25(2)
                                                                                      --------->AHL20(2)
                                                                                      <---------AHL25(3)
                                                                                      <---------AHL12(1)
                                                                                      --------->AHL12(1)
                                                                                      <---------AHL25(1)
                                                                                      --------->AHL20(1)
                                                                                     <---------AHL20(3)
                                                                                     <---------AHL25(2)
                                                 --------->MYB111(1)                 <---------AHL25(1)
                                                <--------P                           --------->AHL20(3)
                                              <---------ANAC58                       --------->AHL12(3)
                                              <---------ANAC58                       <---------AHL12(3)
                                              <------MYB83                           --------->AHL20(2)
                                              <------MYB46(1)                    --------->YAB1
                                             <---------MYB46(3)                <---------WOX13(2)
                                             --------->MYB55(2)                --------->WOX13(2)
                                   <-----------GT1                            --------->WOX13(1)
                                 <---------WOX13(1)                      <---------AHL12(1)      ---
                              <---------ATHB12<---------ANAC46           --------->AHL12(1)      <--
                          --------->ZAT18<---------MYB46(3)            --------->AHL12(2)   --------
                       --------->DOF5.7(1)   --------->MYB59       ----------->GT1   <---------AHL20(2)
       --------->DAG2--------->DOF5.7(1) <-----------RAV1(1)       --------->TOE2(3) --------->AHL25(3)
-->GT1---------->DOF2---------->DOF2 <---------YAB1               ----------->GT1--------->AHL20(2)
 
ataccaaaaaaaagttcaaggagaaaaagaccactgatttacaattgttgggtagtttgaagtcccaaaatgttaaaaattcaattaaaaaaattgtgac  26807400
                                       <---------AHL20(2)
                                       <---------AHL25(2)
                                       <---------AHL25(1)
                                       <---------AHL20(1)
                                       <---------AHL25(3)
                                       <---------AHL20(3)
                                   <---------AHL25(1)
                                   --------->AHL25(1)
                                   --------->AHL12(3)
                                   <---------AHL25(3)
                                   <---------AHL20(2)
                                   <---------AHL12(3)
                                  --------->AHL25(3)               <---------ICU4
                                  <---------AHL12(1)               --------->YAB1
                                  --------->AHL20(2)               -------->HAHB4
                                  --------->AHL12(1)              <---------YAB1
                                <---------ARR11(3)               <---------WOX13(2)
     --------->DOF5.7(1)        --------->GATA12                 --------->WOX13(2)
    <---------AHL20(2) <---------ARR11(2)              --------->GLK1(2)
    <---------AHL20(3) <---------GLK1(2)              <---------ARR14(2)
    <---------AHL12(3) <---------ARR14(2)             <---------GLK1(2)
   --------->YAB1      --------->ARR14(2)             --------->ARR14(2)
   --------->AHL20(2)  <---------GATA12--------->AHL20(3)      --------->AHL20(2)
  <---------------AGL15<---------RVE1(2)             <------ZmHOX2a(1)
 <-----------------AGL3--------->GATA12--------->AHL20(1)      <---------YAB1
 <---------WOX13(2)    --------->ARR11(2)           <---------YAB5<---------YAB5
------>At4g35610  --------->At4g35610  --------->AHL20(2)      <---------AHL20(2)                  -
-------At4g35610  <---------At4g35610  --------->AHL25(1)      --------->AHL25(1)                  <
--->HVH21     <----------DOF2   --------->ARR11(3) <---------TOE2(3)                            <---
 
agctaataaaaatggaactttagctggattcggaagatttattttattgaaaataaggattctgttttaattatagctctaatacagttgaattggtttt  26807500
<- Previous    Next ->

AGI:  At5g67120.1   
Description:  zinc finger (C3HC4-type RING finger) family protein. similar to zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] (TAIR:AT1G45180.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO61373.1); contains InterPro domain Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083); contains InterPro domain Zinc finger, RING-type; (InterPro:IPR001841)
Range:  from: 26805056    to: 26806963    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version