AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
        ----------->GT1
      <-------GAMYB
     <---------MYB46(3)                                                   <---------HSFB2a(2)
     --------->MYB55(2)                                              <----------DOF2
     --------->MYB111(2)                                           <---------HSFC1(2)
    <--------P                 >>>>>>>>>TBF1                       --------->HSFC1(2)              <
--------->DOF5.7(1)      >>>>>>>>>TBF1     <------MYB83         <------ZmHOX2a(1)             ------
-------->DAG2  --------->DOF5.7(1)         <------MYB46(1)    <---------TOE2(3)    --------->ARR11(3)
-------->DOF5.7(1) <------ZmHOX2a(1)   --------->ATHB12 ----------->HVH21 --------->HSFB2a(2)<------
------->DOF5.7(1)------------------------>ANAC81      --------->At4g35610 <---------HSFC1(1) -------
-------->DOF2---------->DOF2>>>>>>>>>TBF1<--------P   <---------At4g35610 --------->HSFC1(1) <------
 
aaaaagggttgttgttaaaagaggagaagaagaagaagaacatggttggcattgttgagatgactgaggaagcttttctagagaaatatgttgtgagatt  25972200
                                                                                           <--------
                                                                                   --------->WOX13(2)
                                                                                   <---------WOX13(2)
                                                                                ------>ZmHOX2a(2)
                                                                               <------ZmHOX2a(2)
                                                                               --------->CCA1(2)
                                                                              <---------GATA12
                            <---------ANAC46                                  --------->GATA12
                         <--------P                                           <---------ARR14(2)
                        <-------GAMYB                                         <-----------ARR10
                --------->ARR11(2)                                            <---------AGP1
                <---------ARR14(2)    <---------ANAC46                        --------->ARR14(2)
<---------At4g35610    <---------MYB46(3)                                     <---------ARR11(3)
---------RVE1(2)--------->ARR14(2)    <---------ANAC58                  --------->RVE1(2) --------->GATA12
--->CCA1(2)     <---------ARR11(2)    <---------ANAC58               ------>ZmHOX2a(2)    <---------GATA12
---GATA12<---------At4g35610<---------ANAC58              --------->ANAC58    --------->ARR11(3)
-->GATA12--------->At4g35610<---------ANAC58              --------->ANAC46    --------->AGP1  <-----
---RVE1(2)     <------ZmHOX2a(1)     <-------TEIL         --------->ANAC58    --------->RVE1(2)
 
tggagatgagattgctgaggaactgctggttgcttacaagtgcgtgtgtttagtcgatgaaacgctacttgatcgtatcaagatctaattgtagatttca  25972300
                                                               <---------YAB1
                                                               --------->AHL25(3)
                                                              <---------AHL25(2)
                                                              --------->AHL25(2)
                                                              <---------AHL20(1)
                                                              --------->AHL20(2)                  <-
                                              --------->ARR11(2)                                  <-
                                              <---------ARR11(2)                                <---
                                              <---------ARR14(2)                              <-----
                                              --------->ARR14(2)                              ------
                         <---------ARR11(2) --------->LBD16   <---------AHL20(2)             <------
                         --------->ARR11(2)--------->ANAC55(2)<---------AHL20(3)           <--------
                         --------->RVE1(2) <---------ANAC55(2)--------->AHL20(3)           <--------
-GLK1(1)          <---------YAB1           --------->ANAC46  --------->YAB1               <---------DOF5.7(1)
------GT1         <---------YAB5       --------->KAN1       <---------YAB1            <-----------GT1
 
caagtccaaacttgaaattttgtcattgtatccaaacttcgctcatccgtaactgtgttgaacattataatttggaagtaactcttaaatcaccctttat  25972400
                      -------->HAHB4
                      <---------ICU4
                      --------->YAB1
                     <---------YAB1
                     --------->ICU4
                     <---------ATHB51
                    <---------AHL20(3)
--------ANAC58      <---------AHL20(2)
--------ANAC58      <---------AHL25(2)
--------GT1         --------->AHL20(3)
----WOX13(2)       --------->YAB1
--->WOX13(2)      <---------AHL20(2)                                                               <
---ICU4 <---------HSFC1(2)                    <----------DOF2                         ---------->DOF2
-DOF5.7(1)       --------->AHL20(2)        --------->GLK1(2)                    <---------GLK1(2)  -
--DOF2  --------->HSFC1(2)    <-------TEIL<---------GLK1(2)<---------At4g35610<---------YAB1       <
 
tacgagcttgaagcttctcatataataatgggattcatatgaagcgattctttttctatttcagcacttgagcaaaaactcaagattgtcaaagcgtctt  25972500
                                                                                                  --
                                                                           <---------KAN1        ---
                                                                        --------->LBD16         ----
                                              --------->MYB52(1)       <---------HSFB2a(2)      ----
                                          --------->YAB1               <---------ANAC46         <---
                                     <-------GAMYB                --------->KAN1      <---------TOE1(3)
             ------->TEIL           <---------MYB46(3)            --------->YAB5      <---------TOE1(2)
---------AHL25(2)                   --------->MYB52(2) <-----------GT1<---------LBD16 <---------TOE2(2)
-------->AHL12(1)          <---------RVE1(2) <-----------GT1   <------------CBF---------->DOF2<-----
---------AHL12(1)<-----------GT1   <-------TEIL  ----------->GT1<---------WOX13(1)    <---------TOE2(3)
 
aaaaatttgactcatgaatttaaccggtttgattttggttcgttgtaataaccggtttaaaccagagattgattccggataaaaaagcttaggtttttcc  25972600
      <---------ALFIN1
      *TSS
    ------>NtERF2
    <---------RAP2.6(3)
   >>>>>>>>>>DREB2A
   <---------ETT(1)
   ----------->HVH21
   --------->DEAR3(1)
   --------->RAP2.6(2)
   >>>>>>>>>>DREB1A----------->GT1                                            <---------At4g35610
  --------->DEAR3(2)                                                          --------->At4g35610
 --------->At4g35610                                                          <---------ZAT2      --
 <---------At4g35610        --------->TOE2(3)                                 --------->ZAT2 -------
-------->DOF2     <------MYB46(1)        <------NtERF2           <----------ID1       <---------GLK1(1)
------>ANAC46     <------MYB83          --------->LBD16          ----------->HVH21    --------->GLK1(1)
----->HSFB2a(2) <--------P  --------->TOE1(2)                 <------ZmHOX2a(1)  --------->At4g35610
----->LBD16  <---------TOE2(3)        <---------LBD16       --------->ALFIN1 --------->ARR14(2)  ---
------HSFB2a(2) --------->ALFIN1   <---------KAN1         --------->DOF5.7(1)--------->GLK1(2)<-----
----LBD16    --------->MYB59--------->TOE1(3)     --------->DOF5.7(1)        <---------ARR14(2)  <--
 
gcgaagccgacactgtaaggtagggctaaaaccttagaatagccggagagaagaaggcgagaagaggagcgacaagggcgaagctgcagaattcttcggt  25972700
                             ------>NtERF2
                            <---------DEAR3(1)
                            <---------RAP2.6(2)
                           <---------LBD16
                           <---------At4g35610
                           --------->At4g35610
                           --------->ATERF1(1)
                           <------NtERF2
                          <---------ATERF1(1)
                          <---------ERF1
                          <---------RAP2.3(1)
                         <---------DEAR3(1)
                        <------NtERF2
                        <---------At4g35610
                        --------->At4g35610
                        ----------->RAV1(2)
                        --------->ATERF1(1)
                        <-------GAMYB                                      <------ZmHOX2a(2)
                      <---------DEAR3(1)                                   --------->GLK1(1)
                      <---------RRTF1(2)                                  --------->GATA12
                      <---------RAP2.3(3)                                 --------->ARR14(3)
                      <---------DREB2C(2)                                 --------->ARR11(3)
                      <---------RAP2.3(2)                                 <---------GATA12
       <-------TEIL   <---------RAP2.6(2)                                 <---------ARR14(3)
      --------->ARR14(1)<---------ZAT2                                    <---------ARR14(2)
      --------->GLK1(2) --------->ZAT2                                    <---------ARR11(3)
     --------->ARR14(2)<---------MYB46(3)                             <---------LBD16
     <---------GATA12 <---------ATERF1(2)                         --------->ARR14(2)
     <---------ARR14(2)<---------RAP2.3(1)                        <---------GATA12
     <---------RVE1(2)--------->ATERF1(2)                    <---------ALFIN1
     --------->GATA12 <---------ANAC46                   --------->ATERF1(1)------>ZmHOX2a(2)
     <---------ARR11(2)<---------RRTF1(1)               <---------ATERF1(1)<---------GLK1(1)
     <---------GLK1(2)<---------RRTF1(3)               --------->ARR14(2) <---------ARR11(2)
     --------->ARR11(1)<---------ERF1                 ============================HOX2a_HOX2a   <---
     --------->ARR11(2)------>NtERF2          --------->GATA12    <---------ARR14(2)            ----
    --------->KAN1    <---------ANAC58   <-------GAMYB<------ZmHOX2a(1)   --------->ARR11(2)    <---
------->ICU4          <---------ANAC58   <---------WOX13(2) --------->MYB46(3)              <-------
---->GT1  <-------GAMYB<---------ATERF1(1)    <---------GATA12 <-----------------AGL1       <-------
------>WOX13(2)      --------->RAP2.6(3)----------->GT1<---------ARR14(2) --------->ARR14(2)<-------
----MYB52(1)     <---------ICU4 <----------DOF2       xxxxxxxxxxxxxxxx>smallRNA(i) <---------ZAT6
-------WOX13(2)  --------->YAB1<---------DOF5.7(1)    =============================HOX2a_HOX2a  ----
 
aattttcagattcggttgaataatggcggctgcggcttttgggcagttaaatctagaggagcctccaccgatttggggatctcgtagtgtcgattgcttc  25972800
                                                                                  --------->AHL25(1)
                                                                                  <---------AHL12(3)
                                                                                  --------->AHL20(2)
                                                                                  <---------AHL20(2)
                                                                                  <---------AHL25(1)
                                                                                  <---------AHL25(3)
                                                                                 <---------AHL20(2)
                                                                                 <---------AHL12(1)
                                                                                 --------->AHL12(1)
                                                                                 <---------AHL25(1)
                                                                                 --------->AHL25(2)
                            <---------ANAC55(1)                                  <---------AHL25(2)
--------->GLK1(2)           <---------ANAC58                                     --------->AHL20(2)
------HSFB2a(2)             <---------ANAC58                                     --------->AHL20(1)
----->HSFC1(1)             <---------LBD16                                       --------->AHL25(1)
------HSFC1(1)<------MYB46(1)--------->LBD16                                     <---------AHL20(1)-
--ANAC58      <------MYB83--------->MYB52(1)                         <---------ANAC46        <------
--ANAC58    <---------WOX13(1)  --------->KAN1          <---------LBD16          --------->AHL25(3)<
--ANAC46   <---------GLK1(2)<---------ANAC46    <---------DOF5.7(1)  <---------ANAC58  <------MYB46(1)
----->HSFB2a(2) <---------REM1(1)              <----------DOF2       <---------ANAC58  <------MYB83<
 
gagaagcttgaacagattggtgaaggaacttacgggtattcttctccattctttttttttctgggttttgttccttgattccaatttatttggttttgtc  25972900
                                                                                               -----
                                                                                              ------
                                                                                     <---------RVE1(2)
                                                                                     >>>>>>>>>ARR2
-------->ZAT14                                                                      --------->ATHB12
-----HVH21                                           --------->O2                  <---------YAB1 --
---------ZAT18           <---------------AGL15     <---------ALFIN1              --------->YAB1-----
---------ZAT14           ===========================================================================
 
agagtactcgtgctcaagactgaaatttctcaaatttgaacgatttcgctagggccacttgatatataagtttttttgaaacaattttgattgtgaaacg  25973000
                                                                      <---------RVE1(2)
                                                                --------->KAN1
                                                               <---------AHL20(3)
                                                               <---------AHL25(1)
                                                               --------->AHL25(1)
                                                               --------->AHL12(1)
                                                               <---------AHL12(1)
                                                               <---------AHL25(3)
                                                               --------->AHL25(3)
                                                               --------->AHL25(2)
                                                               <---------AHL25(2)
                                                               <---------AHL20(1)
                   --------->ARR11(3)                          --------->AHL20(3)
                   <---------ARR11(3)                          --------->AHL20(1)
               ------>ZmHOX2a(2)                               --------->AHL20(2)
               =====================================================================================
        --------->ATHB12                                       <---------AHL20(2)
       <---------YAB1            <---------TOE2(3)            <---------ATHB12              --------
       <---------YAB5       <---------RVE1(2)                 --------->AHL25(3)            <-------
---->TOE2(3)   ===========================HOX2a_HOX2a  --------->RVE1(2)                    --------
----->GT1      ----------------->AGL3                 <---------CCA1(2)        <---------WOX13(2)
------->AHL20(2)  <---------CCA1(2)<------ZmHOX2a(1)<---------DOF5.7(1)       --------->ATHB12
---->YAB5  <---------YAB5  --------->ATHB12  <----------DOF2  --------->AHL20(2)<---------WOX13(1) -
=================================MADS_MADS<-----------GT1--------->TOE2(3)   <---------YAB1 <-------
 
tttatatatagttattgatccatatattgttgatttgaggaattttaactttgcctcttatctcaataaattcgattttgttgattgaatttgggaattc  25973100
<- Previous    Next ->

AGI:  At5g64950.1   
Description:  mitochondrial transcription termination factor-related / mTERF-related. similar to mitochondrial transcription termination factor family protein / mTERF family protein [Arabidopsis thaliana] (TAIR:AT5G07900.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO71777.1); contains InterPro domain Mitochodrial transcription termination factor-related (InterPro:IPR003690)
Range:  from: 25971070    to: 25972386    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g64960.1   
Description:  CDKC;2 (CYCLIN-DEPENDENT KINASE C;2); kinase. Identical to Cyclin-dependent kinase C-2 (CDKC-2) [Arabidopsis Thaliana] (GB:Q8W4P1;GB:Q9LV82); similar to CDKC,1 (CYCLIN-DEPENDENT KINASE C,1), kinase [Arabidopsis thaliana] (TAIR:AT5G10270.1); similar to 80A08_23 [Brassica rapa subsp. pekinensis] (GB:AAZ67608.1); similar to 80C09_20 [Brassica rapa subsp. pekinensis] (GB:AAZ41831.1); similar to cdc2MsC [Medicago sativa] (GB:CAA65979.1); contains InterPro domain Serine/threonine protein kinase; (InterPro:IPR002290); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR01100
Range:  from: 25972607    to: 25976221    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version