AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                              <-----
                                                                                              ------
                                                                                              <-----
                                                                                        <---------ICU4
                                                                                       <---------AHL20(2)
                                                                                    <---------AHL25(3)
                                                                                   <---------AHL25(1)
                                                                                   --------->AHL25(1)
                                                                                   --------->AHL12(1)
                                                                                   --------->AHL25(2)
                                                                                   <---------AHL25(2)
                                                                                   --------->AHL25(3)
                                                                                   <---------AHL25(3)
                                                                                   <---------AHL12(1)
                                                                                   <---------AHL20(1)
                                                                                   --------->AHL20(2)
                                                                                   <---------AHL20(2)
                                                                                   --------->AHL12(3)
                                                                                   <---------AHL20(3)
                                                                                  --------->AHL25(3)
                                                                                 --------->WOX13(2)
                                                                                 <---------WOX13(2)
                                                                                 --------->AHL12(2)
                                                                                <---------ICU4------
                                                                               --------->AHL12(1)  <
                                                                               <---------AHL12(1)  -
  ------>NtERF2                                                              --------->YAB1<--------
----YAB1                <-----------GT1                                      --------->ANAC55(2)  --
-ARR11(2)   <-----------GT1             <-----------GT1                      --------->ANAC46 ------
>ARR11(2) <---------AHL20(2)    ---------->DOF2            ----------->HVH21<-------TEIL--------->YAB5
 
aatgcctccatattttaacagtgtttataacttcttaaagtttttactatgcaagttgtcttatgacacagagctaatatacataattaattcattacct  25908300
      --------->WOX13(2)
    --------->AHL12(3)
    <---------AHL12(1)
    <---------AHL20(2)
    --------->AHL20(2)
    <---------AHL25(3)                                                                --------->WOX13(2)
    <---------AHL12(3)                                                               <---------ICU4
    --------->AHL25(3)                                                              --------->AHL20(3)
    <---------AHL25(2)                                                              <---------AHL20(3)
    --------->AHL25(1)                                                              <---------YAB1
    --------->AHL12(1)                                                              --------->AHL25(1)
    <---------AHL25(1)                                                              --------->AHL20(2)
   --------->AHL25(3)                                                               <---------AHL20(2)
   --------->AHL20(2)                                                               <---------AHL12(1)
  --------->AHL12(2)                                                                <---------AHL12(3)
  --------->WOX13(2)                                                                <---------AHL25(1)
<---------AHL12(3)                                                                  --------->AHL12(3)
<---------AHL20(2)                                                                  --------->AHL12(1)
--------->AHL20(3)                                                                 --------->AHL25(3)
--------->AHL20(2)                                                                <---------AHL12(2)
--------->AHL25(1)                                                                --------->AHL12(2)
<---------AHL12(1)                                                               <---------AHL20(1)
--------->AHL12(3)                                                               <---------AHL25(3)
<---------AHL25(3)                                                               --------->AHL20(1)
<---------AHL20(3)                                                              --------->AHL12(1)
<---------AHL25(1)                                                              <---------AHL12(1)
--------->AHL12(1)                                                              --------->AHL25(1)
----DAG2--------->AHL20(2)                                                      <---------AHL12(3)
--->TOE1(3)                                                                     --------->AHL20(2)
----MYB59<-----------GT1                                                        --------->AHL12(3)
--------->AGL15                                                                --------->AHL12(2)
---------AHL20(2)                                                  <---------AHL20(1)--------->YAB5
-------->AHL25(3)                                            <---------KAN1   --------->AHL20(3)
---GT1<---------WOX13(2)                               <-----------HVH21      --------->AHL20(2)
------->AHL12(2)       <---------TOE2(3)           <---------ARR11(2)   <-----------GT1
--->TOE2(3)           ---------->DOF2             <---------KAN1----------->GT1<---------AHL12(2)
 
tatttatttaatttactagacttgttaaagtattcttcagaactgttcatagagtataggtcgcatatagtatatttacaaaaatatataattactcaca  25908400
                                         <---------AHL12(2)
                                        <---------AHL20(2)
                 <---------ANAC55(2)    --------->AHL25(2)
                <-------TEIL            --------->AHL12(1)
               --------->ARR14(1)       <---------AHL12(1)
               --------->CCA1(2)        --------->AHL20(2)
              --------->ARR14(2)        <---------AHL25(2)
              <---------ARR14(2)        --------->AHL25(3)
              <---------ARR11(2)   <---------MYB59
              <---------GLK1(2)   --------->ANAC58
              --------->ARR11(2)  --------->ANAC58
              <---------RVE1(2) <------ZmHOX2a(1)
          <-------TEIL    <---------YAB1--------->AHL25(1)              --------->YAB1
         --------->CCA1(2)<---------AHL20(2)                           <---------ATHB12
      --------->DOF5.7(1)--------->AHL20(2)                     ----------->GT1      <---------AHL12(1)
    ---------->DOF2    --------------->AGL15<-----------GT1 --------->WOX13(2)     ------>MYB46(1)
 <---------ANAC46--------->ANAC55(2)    --------->AHL20(3)  <---------WOX13(2)     ------>MYB83
 
agttgcgaaaagattcagatacgtttcatataataggacccaattttttacaaaatttgttcaaattgagttaaatcatcaaaaccaaattttcttctgt  25908500
                                                   --------->AHL20(2)
                                                   --------->AHL12(3)
                                                   <---------AHL20(2)
                                                 --------->AHL12(3)
                                                 <---------AHL20(2)
                                                 --------->AHL20(2)
                                                 <---------AHL12(3)
                                               <---------AHL20(2)
                                               --------->AHL12(3)
                                               <---------AHL12(3)
                                               --------->AHL20(2)
                                             <---------AHL12(3)
                                             --------->AHL12(3)
                                             <---------AHL20(2)
                                             --------->AHL20(2)
                                           --------->AHL12(3)
                                           <---------AHL12(3)
                                           <---------AHL20(2)
                                           --------->AHL20(2)
             --------->AHL20(3)          --------->AHL12(3)
             --------->AHL20(2)          --------->AHL20(2)
             <---------AHL20(2)          <---------AHL20(2)
             <---------AHL12(3)          <---------AHL12(3)
             <---------AHL20(3)        --------->AHL20(2)
             --------->AHL12(3)        <---------AHL20(2)             <---------AHL20(2)       -----
            --------->YAB1             <---------AHL12(3)             --------->AHL20(2)       <----
        <---------AHL25(3)             --------->AHL12(3)           <---------YAB1             <----
        <---------AHL20(2)           --------->AHL12(3)          <---------YAB5         <---------ARR11(2)
        --------->AHL20(2)           <---------AHL12(3)     --------->TOE2(3)      <---------ANAC58
       --------->AHL20(2)            --------->AHL20(2)    <---------ICU4          <---------ANAC58
       --------->AHL20(3)            <---------AHL20(2)   <---------YAB5           <---------ANAC46<
  <------ZmHOX2a(2)               <---------AHL20(2)   <---------AHL20(2)  <---------AHL12(2) <-----
 <---------GATA12                --------->AHL20(2)<---------AHL12(3)--------->AHL20(2) --------->ARR11(2)
 
tatagatcaaatttataaaaatagctatttgctatattatatatatatatatatatatataaacattagttattaaaaaaaaaactgcgtgtttccagtt  25908600
                                                                           --------->AHL20(2)
                                                                           --------->AHL20(1)
                                                                           --------->AHL25(2)
                                                                           <---------AHL25(3)
                                                                           --------->AHL25(3)
                                                                           --------->AHL25(1)
                                        <------NtERF2                      <---------AHL25(1)
                                       <---------At4g35610                 <---------AHL12(3)
                                       ------>NtERF2                       <---------AHL25(2)
                                       --------->At4g35610                 <---------AHL20(2)
                                      <---------DEAR3(1)                   --------->AHL12(3)
                                      <---------ANAC46                     <---------AHL20(1)
                                     --------->RAP2.3(1)                  <---------AHL25(1)
                                     --------->ATERF1(1)                  --------->AHL20(2)
                                     <------NtERF2                        --------->AHL25(1)
                                    <---------ATERF1(1)                   <---------AHL20(2)
                                    <---------ORA47(2)                    <---------AHL25(3)
                                    <---------RAP2.3(1)                   --------->AHL25(3)
                                    <---------DEAR4(2)                    <---------AHL25(2)
                                    <---------RRTF1(1)                    --------->AHL25(2)
                                    <---------RAP2.6(1)                   --------->AHL12(1)
                                    <---------ERF1                        --------->AHL12(3)
                                   <---------RAP2.3(2)                    <---------AHL12(1)
                                   <---------DEAR3(1)                   --------->AHL12(2)
                                   <---------DREB2C(2)                  <---------AHL12(2)
                                   <---------RRTF1(2)          --------->ZAT6           --------->WOX13(1)
                                   <---------RAP2.6(2)    <---------AHL12(2)         <---------ARR11(3)
     <---------ZAT14       <---------YAB1      <---------------AGL15    --------->WOX13(2)
     <-------TEIL ------>NtERF2    <---------RAP2.3(3)    <---------WOX13(2)         --------->RVE1(2)
---->ZAT14       --------->DEAR3(1)--------->ATERF1(2)    --------->WOX13(2)<---------AHL12(2)
-----ZAT14       --------->RAP2.6(2)------>NtERF2   ---------->DOF2--------->ANAC58  --------->ARR11(3)
-----ZAT18      --------->DEAR3(2) <---------RRTF1(3)   --------->AHL20(2)<---------AHL12(3) -------
---------LBD16 --------->At4g35610 <---------ATERF1(2)----------->GT1   <---------WOX13(2)   <------
------HVH21   --------->GLK1(2)   <---------LBD16--------->AtLEC2  --------->ANAC58 <---------CCA1(2)
 
cacacgggtacagagagaagccgactcattttcatttggcggcgctgaaaccatacaaagtaattaacacaagaaaattaaatttgtatatctatcagct  25908700
                                               <----------DOF2        <---------ANAC58
           ---------->ID1                  <----------DOF2            <---------ANAC58
       ------>ZmHOX2a(1)                  <---------DOF5.7(1)         <---------ANAC46
       <----------DOF2            <---------ARR11(3)         ---------->ID1
  --------->TOE1(1)               --------->ARR11(3)     <----------DOF2
  --------->TOE2(1)               --------->RVE1(2)     <---------DOF5.7(1)
-->At4g35610                   *TSS--------->RVE1(1)   ------>ZmHOX2a(1)                     -------
---At4g35610                  --------->HSFB2a(2) <------------------------ANAC81            <------
 
aaacctcgtcctttgtcttaaaaaacacatcttctaaaatctctgtctttctttcttcctctttgtctctgtttcttgtttctctctctctctctctaca  25908800
                                         <-----------GT1
                                      <---------WOX13(2)
                                      <---------AHL12(2)
                                      --------->AHL12(2)
                                    --------->AHL25(1)
                                    <---------AHL25(1)
                                    <---------AHL25(2)
                                    <---------AHL25(3)
                                    <---------AHL20(2)
                                    --------->AHL25(2)
                                    --------->AHL12(3)
                                    <---------AHL12(3)
                                    --------->AHL25(3)
                                    --------->AHL12(1)
                                    <---------AHL12(1)
                                    --------->AHL20(2)
                                   <---------AHL20(1)
                                   --------->AHL20(1)
                                   <---------AHL20(2)
                                   <---------AHL25(3)
                                   --------->AHL25(3)
                                   <---------AHL25(1)
                                   --------->AHL25(1)
                                   --------->AHL20(2)
                                   --------->AHL12(3)
                                   <---------AHL12(3)
                                   <---------AHL25(2)
                                   --------->AHL25(2)
                                  --------->AHL12(2)
                                 --------->WOX13(2)
                               <---------AHL20(2)
                              <---------AHL20(2)
                              --------->AHL20(2)
                          --------->AHL25(2)
                          <---------AHL12(2)
                          --------->AHL12(3)
                          <---------AHL12(3)
                         --------->AHL12(1)
                         --------->AHL20(3)
                         <---------AHL20(3)
                         <---------ARR11(3)
                         --------->AHL12(2)
                         --------->ARR11(3)
                         --------->AHL25(2)                                             --------->DOF5.7(1)
                         <---------AHL25(2)                                     <---------GATA12
                         <---------AHL12(1)                                     --------->ARR14(2)
                         <---------AHL20(1)                                     <---------ARR14(2)
                         --------->AHL20(1)                                    <------ZmHOX2a(1)
                        <---------KAN1--------->WOX13(2)                    <------ZmHOX2a(1)
    <----------DOF2     <---------AHL12(1)                               <------ZmHOX2a(1)
-->ZAT14                --------->AHL12(1)      <---------ANAC46      <---------At4g35610<------ZmHOX2a(1)
---ZAT14          ---------->DOF2<---------WOX13(2)        <----------DOF2--------->ALFIN1
 
gagttttctttccctcgaagaaaaagaatatttttaaatttaattttctctgcgtttataagctttaagtttcagaggaggaggatttagaaggagggtt  25908900
                                                                                 --------->DOF5.7(2)
                                                                              <---------TOE2(2)
                                                                              <---------TOE1(2)
                                                                              --------->SPL7(1)
                                                                           --------->TOE1(1)
                                               --------->DOF5.7(1)        --------->At4g35610
                                              --------->DOF5.7(1)      <---------YAB5
                                              --------->DAG2           <---------YAB1
                                  <---------TOE1(3)                   <---------ARR11(3)
                                  <---------TOE2(3)                   --------->ARR11(3)
                       <---------ATHB12      ---------->DOF2         --------->YAB1
                 ----------->GT1 --------->MYB52(1)                  --------->YAB5 --------->At4g35610
             --------->DAG2      <---------DOF5.7(2)                <---------YAB1  <---------At4g35610
            ---------->DOF2    --------->ARR11(3)        <---------WOX13(2)--------->TOE2(1)   <----
        <---------ANAC46   <------ZmHOX2a(1) --------->DOF5.7(1)  --------->YAB5 <---------MYB52(1)
 
ttgtatgtgtgtcttaaaagtggcaaatcaggaagataacgttggcaaaaaagccgagtctattagagacgatgatcatcggacgttatctgaaatcgat  25909000
                                                                ------>NtERF2
                                                               --------->DEAR3(1)
                                                              --------->ATERF1(1)
                                                              <------NtERF2
                                                              --------->RAP2.3(1)
                                                             ------>NtERF2
                                                             <---------ATERF1(1)
                                                            --------->RAP2.3(2)
                                                            --------->RAP2.6(2)
                                                            --------->RAP2.3(3)
                                                            --------->DEAR3(1)
                                                            ------->GAMYB
                                                           --------->ERF1
                                                           --------->RAP2.3(1)
                                                          --------->ZAT2
                                                          --------->At4g35610
                                                          <---------ATERF1(1)
                                                          <---------At4g35610
                                           <---------ANAC58--------->MYB46(3)
                                           <---------ANAC58--------->ATERF1(1)
                 ------>NtERF2     --------->DEAR3(1)    --------->DEAR3(1)
                 --------->ZAT2 <---------ALFIN1        --------->ATERF1(1)
                 --------->At4g35610<-----------HVH21   --------->MYB46(3)
                 <---------At4g35610<-----------TGA1   --------->ZAT2
                --------->DEAR3(1) --------->DREB2C(2) <---------ZAT2              <---------CCA1(2)
         --------->KAN1         --------->AtMYB61      --------->At4g35610      ------>ZmHOX2a(1)
       --------->ANAC55(2)      --------->DEAR3(1)     <---------At4g35610  <---------SPL7(1) <-----
   <----------DOF2             --------->MYB46(3)  --------->ANAC58       --------->ATERF1(1) <-----
  <---------ANAC58             <---------MYB55(2)  --------->ANAC46       <---------YAB5 --------->RVE1(2)
  <---------ANAC58          --------->MYB46(3)     --------->ANAC58       <------NtERF2 <---------CCA1(2)
--ZmHOX2a(2) --------->ANAC46--------->AtMYB61    --------->SPL7(1)     <---------DEAR3(1)   <------
 
caatggctttacttattcgcagccgaagacgaccaccaccgtcatagcttccctacgcagcagccgcctccatcgtcgtcgtcctcatctcttatctcag  25909100
                                                                                               <----
                                                                                               -----
                                                                                              ------
                                                                                          <---------TOE1(3)
                                                                                       ----------->HVH21
                                                                                       --------->ALFIN1
                                                                                      --------->At5g28300
                                                                  ------>ZmHOX2a(1)   <------NtERF2
                                                            --------->HSFB2a(1)     <---------ANAC46
                                                      --------->HSFB2a(2)           --------->ALFIN1
                                                     <---------ANAC58               <---------DEAR3(1)
                                                     <---------ANAC46              <------NtERF2<---
         --------->CCA1(2)                      <-----------RAV1(1)                --------->ATERF1(1)
        xxxxxxxxxxxxxxxx>smallRNA(i)  --------->WRKY38(1)   <---------HSFB2a(1)    <---------ABI4(1)
----TOE2(2)                           --------->WRKY45<---------HSFB2a(2)        --------->ALFIN1---
----TOE1(2)           <---------At4g35610    <---------O2   --------->KAN1       <---------DEAR3(1)
-----RAV1(2)   <---------At4g35610  <----------DOF2  <---------ANAC58--------->At4g35610  <---------TOE2(3)
 
gtttcagtagagagatggagatgtctgctattgtctctgctttgactcacgttgttgctggaaatgttcctcagcatcaacaaggaggcggtgaaggtag  25909200
<- Previous    Next ->

AGI:  At5g64750.1   
Description:  ABR1 (ABA REPRESSOR1); DNA binding / transcription factor. Identical to Ethylene-responsive transcription factor ABA REPRESSOR 1 (ABR1) [Arabidopsis Thaliana] (GB:Q9FGF8); similar to DNA binding / transcription factor [Arabidopsis thaliana] (TAIR:AT5G50080.1); similar to 80C09_8 [Brassica rapa subsp. pekinensis] (GB:AAZ41819.1); contains InterPro domain DNA-binding, integrase-type; (InterPro:IPR016177); contains InterPro domain Pathogenesis-related transcriptional factor and ERF, DNA-binding; (InterPro:IPR001471)
Range:  from: 25908732    to: 25911114    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version