AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                              <-----
                                                                                             <------
                                                                                             ------>ZmHOX2a(2)
                                                                                             -------
                                                                                            <------ZmHOX2a(2)
                                                                                           <--------
                                                                                           ---------
                                           <--------HAHB4                                  ---------
                   <---------ALFIN1        --------->YAB1                                  <--------
               --------->At4g35610         --------->YAB5                                  <--------
        ---------->DOF2                   <---------YAB5                                  <------ZmHOX2a(1)
     --------->ANAC58          --------->RVE1(2)            --------->YAB1              <---------TOE2(3)
     --------->ANAC58         --------->WOX13(1)      ------>ZmHOX2a(1)            <----------DOF2
--->At5g28300 <XXXXXXXXXXXXXXXXXXXMIR773B*<---------YAB1 --------->YAB1   --------->RVE1(2)---------
 
gaatgctctcgcaaagtttgctccacttgttgccaatctcttcttatcattaagttcctataatcaaaatttcaaaaaatccaaaactttttaggatctt  25646300
                                                                          <------NtERF2
                                                                         ----------->RAV1(1)
                                                                         --------->ANAC58
                                                                         ------>NtERF2
                                                                     --------->ANAC46
                                                                     --------->bZIP60(1)
                                                                     --------->ANAC58
                                                                     <---------bZIP60(1)
                                                                   --------->YAB5                 --
-----DOF2                                                         ----------->TGA1                <-
---DOF5.7(1)                                                      <---------ATHB12                --
-->YAB5                                                        <<<<<<<<<WRKY18                   ---
-GATA12<---------YAB1                             <---------HSFB2a(2)--------->ANAC58          <----
>GATA12--------->ICU4                <---------MYB46(3)      --------->TOE2(3)  --------->At4g35610
>ARR14(2)                            <------MYB83 --------->HSFB2a(2)--------->TGA2(1)         -----
-ARR11(3)                            <------MYB46(1)       <---------YAB5--------->ANAC58 <---------ARR11(2)
-ARR14(2)                        <-----------RAV1(1)    --------->KAN1------>NtERF2   --------->At4g35610
>ARR11(3)    <---------TOE2(3) <----------DOF2  ------>ZmHOX2a(1) ----------->HVH21--------->At4g35610
 
tagcaatgtcaagattgaggcattcaaagacttactttgttggttttgctcctctcgaggtattcgtcaatgacgccagcattagcagaagcagaaacag  25646400
             <---------ZAT14                            --------->WOX13(1)
        --------->DOF5.7(1)                            <-------TEIL
   --------->ZAT14                                    <------ZmHOX2a(2)
  --------->ALFIN1                                   <---------GATA12
------->At4g35610                                    --------->ARR11(2)
--------At4g35610  --------->At4g35610               --------->AGP1               --------->WRKY38(1)
------->ZAT2--------->ALFIN1                         --------->GATA12     --------->MYB46(3)       -
-------->RAV1(1)--------->At4g35610                  <---------ARR11(2)  ------>MYB83  <----------DOF2
-----At4g35610  <---------At4g35610              <---------MYB52(1)      ------>MYB46(1)         ---
---->At4g35610  <---------ZAT2          ------>ZmHOX2a(2)        <---------ICU4  <----------CDC5 ---
 
cagcagtggagaagagtgtagctgctaagaaaaccatggctgatcgtcttccattagatccatcaacatcatcaccaacaacgcgttgagctttgatcac  25646500
                                                                                               -----
                                                                                               -----
                                                                                               <----
                             --------->MYB52(1)                                                <----
                             ------>MYB46(1)                                                  <-----
                             ------>MYB83                                                     ------
                           <---------MYB59           <----------DOF2                          ------
                          --------->ANAC58         ------>MYB83                               <-----
                          --------->ANAC46         ------>MYB46(1)                         <--------
                          --------->ANAC58      --------->MYB46(3)                         <--------
     --------->YAB1     ------>MYB46(1)       ------>MYB46(1)                              <--------
    <---------YAB5      ------>MYB83          ------>MYB83                                 ---------
 <---------KAN1       <---------MYB59       --------->AtMYB61                              <--------
 --------->ICU4       --------->AtMYB61     <---------MYB46(2)                      <------NtERF2
-------->YAB1     ----------->HVH21         --------->MYB46(3)                     --------->ANAC58
------>ANAC58   <---------At4g35610        --------->ANAC46                        --------->ANAC58
------>ANAC58   --------->At4g35610      <-----------GT1                  <xxxxxxxxxxxxxxxxsmallRNA(s)
 
aggcataatcatctgtttcttctgaccaaacccaactgatgaattcaccaaaccaactttctggttaagctctaccgagccagagccagcaattgcgtag  25646600
                                    --------->ARR11(3)
                                    <---------ARR11(3)
                                 <---------TOE2(3)
                                ---------->DOF2
---->ZAT2                  <------NtERF2
---->At4g35610            ------>NtERF2
-----At4g35610            <---------RAP2.6(3)
-----ZAT2                 <------NtERF2
----ARR11(2)             --------->RAP2.6(2)
--->ARR14(2)             --------->DEAR3(1)
--->ARR11(2)             <---------ATERF1(2)                                                  ------
----ARR14(2)             --------->ATERF1(2)                                           <------MYB46(1)
-ANAC46  --------->KAN1  --------->ANAC46                    <---------AHL12(1)        <------MYB83
-ANAC55(2)        <-------TEIL --------->AHL20(2)           --------->AHL12(1)       <---------WOX13(1)
-ANAC58 <---------ZAT14  --------->ANAC58 <---------DOF5.7(1)--------->AHL12(1)     <---------RVE1(2)
>ANAC55(2) <<<<<<<<<TAC1 --------->ANAC58<----------DOF2    <---------AHL12(1)     --------->ATHB12-
-ANAC58 --------->ZAT14 <---------RAP2.6(2)    <----------DOF2                    <---------YAB1   -
 
ctgcaagtgagaacactcgagttcatggccgccattaaagatgtctttttcttttgttcttgaaaaattcaagagttttttgagtttgattggtgagtga  25646700
                                                  =====================================MYC_MYB
                                                  <---------ANAC46
                                                  <---------bZIP60(2)
                                                  <---------O2
                                                  --------->O2
                                                  <---------ANAC58
                                                  <---------TGA1a
                                                  <---------ANAC58
                                                 ----------->bZIP911(1)
                                                 ----------->STF1
                                             <---------ICU4
                                             --------->YAB1                           --------->ALFIN1
                                             --------->YAB5                         <---------ANAC58
                                            <---------YAB1                          <---------ANAC46
                                            --------->ICU4                          <---------ANAC58
                                          --------->YAB5                          <------MYB83
                                          *TSS  <---------TGA2(2)               <--------P
            --------->ARR11(3)           <---------YAB1                        <-------GAMYB  ------
            <---------ARR11(3)           --------->ICU4                       <---------MYB46(3)
            <---------RVE1(2)          --------->YAB5                         --------->MYB55(2)
            <---------GATA12           --------->YAB1                        <---------TOE2(3)<-----
            --------->GATA12        <------ZmHOX2a(1)--------->ZAT18 --------->DOF5.7(1)      ------
--->ZAT18 ----------->ARR10       <---------TOE2(3)  --------->WRKY38(1) <------------CBF  <--------
-------->ANAC58          <---------RVE1(2)--------->YAB1      ----------->GT1<---------YAB1<--------
-------->ANAC58    <---------ZAT6--------->YAB1----------->TGA1    --------->ICU4 <------MYB46(1)  -
 
gcaaggaagagattagattttagtattagagatgaatgaggatgatgatgatgacgtggactaagatgtaataagggattgtggttggagtgtggataag  25646800
  --------->GLK1(1)
  <---------GLK1(1)
 <---------GATA12                                                                    --------->GLK1(2)
 --------->GATA12                                                                   --------->ARR11(2)
--->DAG2                                                                            <---------GLK1(2)
----TOE2(3)                         <---------DOF5.7(1)                             <---------RVE1(2)
--->DOF5.7(1)    <------------CBF   <----------DOF2                <---------TOE2(3)<---------ARR14(2)
-ARR11(2)--------->ZAT14---------->DOF2  <---------YAB1            <---------TOE1(3)--------->ARR14(2)
-RVE1(2)<-----------HVH21          <---------DOF5.7(1)        <----------DOF2       --------->GATA12
---------->ARR10------>ZmHOX2a(1)  <---------DAG2 ---------->DOF2 ---------->DOF2   <---------GATA12
 
gtgagatttcccttcagtcctattggcaaaagtccaaaccttttcttattactcaaagcttcaagcttttaaagtttgagtttttcagattctctcttcc  25646900
                                  --------->ANAC58
                                  --------->ANAC58
                                  --------->ANAC46
                                --------->AtMYB61
                                ----------->RAV1(1)                   <------MYB46(1)           ----
                                <---------ALFIN1                      <------MYB83              ----
                     <---------ZAT14                                 <---------MYB46(3)       <-----
                     --------->ZAT14                                 --------->MYB46(2)       ------
                <-------TEIL --------->ANAC46                        --------->MYB59        --------
              --------->GATA12 --------->ANAC46              --------->RVE1(1)              <-------
              <---------RVE1(2)--------->MYB46(3)           --------->GLK1(2)               --------
              <---------GATA12------>NtERF2                 <---------ARR11(3)              <-------
            ----------->ARR10<---------ALFIN1               --------->ARR11(3)              <-------
         <-------GAMYB      --------->MYB46(3)              --------->RVE1(2)               <-------
        <---------MYB46(3)<---------ZAT18          --------->RVE1(2) --------->MYB111(1)    --------
        ----------->GT1   --------->PCF2          --------->YAB1   <---------MYB52(1)      ---------
 
aagtgtttatgtggttagattcacttcagtccccaccacacaaactctctcaaaaatcacaaaaatctctgtttggtactctgttttcttagtctgatcc  25647000
  <---------WOX13(2)         --------->ARR11(3)
  --------->WOX13(2)         <---------ARR11(3)
 <-----------GT1           --------->ICU4
------->GT1           --------->At4g35610
----->LBD16           ----------->GT1
----LBD16             <---------ANAC55(2)                                                          -
>ZmHOX2a(2)          --------->MYB59                                                              <-
->ARR14(2)          <-----------RAV1(2)                                                         <---
--RVE1(2)         <-----------HVH21                                                             ----
->GATA12         --------->LBD16                                                               <----
--GATA12 <----------DOF2   <---------YAB5--------->YAB5                                        -----
--ARR14(2)      --------->LBD16 <---------LBD16 <---------WOX13(2)                 --------->DOF5.7(1)
--ARR11(2)     <---------LBD16<---------GLK1(1) --------->WOX13(2)               ---------->DOF2----
->ARR11(2)    <-----------------AGL1  <---------ICU4                        <----------ID1   <------
>KAN1    <---------DAG2  ---------->DOF2<---------YAB1 ---------->DOF2   ---------->DOF2  <---------
 
ggtttaactgaactttatcccggtcaggtaaagatttcggattatgactctaatttggcaaagcctatgtttcatagaaagaacaaaagagagcttttac  25647100
              ------>ZmHOX2a(1)
     --------->ARR11(3)
--------->AHL20(3)           <---------ZAT6
-------->YAB1--------->TOE2(3)
--------YAB1 --------->TOE1(3)                   --------->DOF5.7(1)
------------AGL15            ----------->GT1    --------->AHL25(2)
----->YAB5 <---------YAB1  --------->ZAT14      <---------AHL12(3)
-----YAB1 <-----------GT1  <-------TEIL         <---------AHL25(2)
------------>AGL3      <---------------AtSPL3   <---------AHL25(1)
----------->AGL15     ---------->DOF2           --------->AHL20(2)      ---------->DOF2
-----GT1<---------AHL20(2) <---------ZAT14----------->GT1     <---------AHL12(2)
-DOF2<---------ARR11(3)<---------------AtSPL8  --------->AHL12(2)--------->MYB52(1)     <---------TOE2(3)
 
cattataagattttatccttagagagaaagtacagttaaacaaataagaaaaaaaatgaccaaaaaaaaaacagacaaagaagaaaatgttaagaaaaca  25647200
<- Previous    Next ->

AGI:  At5g64040.1   
Description:  PSAN (photosystem I reaction center subunit PSI-N); calmodulin binding. Identical to Photosystem I reaction center subunit N, chloroplast precursor (PSAN) [Arabidopsis Thaliana] (GB:P49107); similar to unknown [Populus trichocarpa x Populus deltoides] (GB:ABK96256.1); contains InterPro domain Photosystem I reaction centre subunit N; (InterPro:IPR008796)
Range:  from: 25645814    to: 25646743    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g64050.1   
Description:  ATERS/ERS/OVA3 (OVULE ABORTION 3); glutamate-tRNA ligase. Identical to Glutamyl-tRNA synthetase [Arabidopsis Thaliana] (GB:Q9FEA2;GB:Q940P6); similar to glutamate-tRNA ligase, putative / glutamyl-tRNA synthetase, putatuve / GluRS, putative [Arabidopsis thaliana] (TAIR:AT5G26710.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN72214.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO47549.1); similar to glutamyl-tRNA synthetase [Nicotiana benthamiana] (GB:AAY18610.1); contains InterPro domain Aminoacyl-tRNA synthetase, class I, conserved site; (InterPro:IPR001412); contains InterPro domain Glutamyl/glutaminyl-tRNA synth
Range:  from: 25647081    to: 25650435    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version