AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                 --------->AHL12(1)
                                                                 <---------AHL12(1)
                                                                --------->AHL20(3)
                                      <------ZmHOX2a(1)         --------->AHL25(2)
                                     ----------->GT1            <---------AHL20(3)
                              <---------YAB1                    <---------AHL25(2)
                            --------->CCA1(2)                   <---------AHL12(2)
                           --------->ARR11(1)                   --------->AHL12(2)
    <---------YAB5         --------->ARR14(2)                  --------->AHL12(1)
------->MYB52(1)           <---------ARR14(2)             --------->LBD16
---->TOE2(3)               --------->ARR11(3)            --------->HSFB2a(2)
---->TOE1(3)               <---------ARR11(3)            <---------HSFB2a(2)
---->YAB5       --------->ANAC58   <-----------RAV1(2)  <---------LBD16       <---------HSFB2a(2)
---->YAB1       --------->ANAC58   --------->YAB1     --------->GLK1(2)       --------->HSFB2a(2) --
----GT1      --------->WOX13(2)  ------->TEIL       --------->KAN1 <-----------GT1<---------GLK1(1)
 
ataactgatcatcttaaactagcaattcaagatatgaatcaggagaaaatgaccaaaattctgggaaaattttcatcttctctagaattcagaaaatgaa  25124800
                                         <---------ICU4
                                         --------->YAB1
                                         <--------HAHB4
                                         --------->YAB5
                                        <---------YAB1
                                        <------ZmHOX2a(2)
                                       --------->ARR11(3)
                                       <---------ARR11(3)
                                      <------ZmHOX2a(1)
                                  ------>ZmHOX2a(2)
                                 <------ZmHOX2a(2)
                                 <---------KAN1
                                --------->GATA12
                                --------->RVE1(2)
                                <---------GATA12
                                <---------AGP1
                                <---------ARR11(2)
                                --------->AGP1
                                <---------ARR11(3)
                                --------->ARR11(3)
                                --------->ARR11(2)
                                <-----------ARR10
                                --------->ARR14(2)
                                <---------ARR11(1)
                                <---------ARR14(2)
                               <---------CCA1(2)
                               <---------ARR14(1)
                              --------->LBD16
                          <---------ARR11(2)            --------->YAB1
                          --------->ARR11(2)--------->ATHB51                                      <-
           <---------YAB1 --------->ARR14(2)--------->ATHB12                                   <----
          --------->TOE2(3) <---------LBD16<---------YAB5                                   ========
        <---------YAB5    --------->GATA12 <---------YAB1        --------->HSFB2a(2)        <------ZmHOX2a(1)
      --------->YAB1      <---------ARR14(2)<---------ICU4       <---------HSFB2a(2)  --------->GLK1(1)
--------->GLK1(2)         <---------GATA12 --------->ICU4      ----------->RAV1(2)    <---------GLK1(1)
------->KAN1        <---------ANAC46  --------->YAB1--------->YAB5             --------->At4g35610==
 
caaattctagcatcatcaatgtctcgttgaatccggatctaggatcattattgaatcaatagtaccttctgggcatagaagaagcagagaaatcaggaac  25124900
                             ===============HOX2a_HOX2a
                             <------ZmHOX2a(2)
                <---------GATA12          --------->TOE2(3)
                --------->GATA12       --------->GLK1(1)
                <---------AGP1------>ZmHOX2a(2)
                <---------RVE1(2)      <---------KAN1
                --------->ARR11(2)     <---------GLK1(1)
             <---------TOE1(2)==============HOX2a_HOX2a
           <---------ANAC46 --------->ARR11(2)
           <---------ANAC58 --------->RVE1(2)
           <---------ANAC58 <---------ARR11(2)
  <---------ANAC58------>ZmHOX2a(2)   <---------ARR14(2)
  <---------ANAC58==========================HOX2a_HOX2a
 --------->HSFC1(2)         --------->GATA12
 <---------HSFC1(2)         <---------ARR14(2)<---------At4g35610
 <---------HSFB2a(1)        <---------GATA12  <---------ZAT2
 --------->ATERF1(1)        --------->ARR14(2)--------->At4g35610 --------->ANAC55(2)
 --------->HSFB2a(1)       <---------RAP2.6(3)--------->ZAT2      <---------ANAC55(2)  --------->YAB1
-----ZmHOX2a(1) <---------ARR11(2)    <---------ARR11(2)        <-----------GT1       <---------KAN1
-------RAV1(2) <---------CCA1(2)      --------->ARR14(2)      --------->WOX13(2)<-----------GT1
=========================HOX2a_HOX2a  --------->ARR11(2)    <---------AHL20(2)--------->KAN1   <----
=========================HOX2a_HOX2a <------ZmHOX2a(1)   <---------WOX13(2)  <---------AHL12(2)-----
 
aggaggcttcccttccttggatctaagagccgatctgagaggatacctcagcttcgagtttattgaattacctgttcagaaattttcgaatcagaaaaac  25125000
                                                              --------->ZAT2
                                                              <---------ZAT2
                                                              --------->At4g35610
                                                              <---------At4g35610
                                                             ----------->RAV1(1)
                                                           --------->At4g35610 <-----------GT1
                                                      --------->HSFB2a(2)  <----------DOF2
                                                      <---------HSFB2a(2)  <---------DAG2
                                                      --------------->AGL15<---------DOF5.7(1)
                                                   <-----------GT1        <---------DOF5.7(1)
                              --------->CCA1(2) --------->GATA12        --------->ANAC58
                         <---------YAB5         <---------ARR14(2)      --------->ANAC58
<---------YAB1        --------->ICU4            <---------GATA12     ----------->HVH21
<---------ANAC55(2)  <---------RVE1(2)          --------->ARR14(2) <---------At4g35610            --
-----ICU4          <---------ZAT6               <---------ARR11(3) --------->At4g35610  <---------GLK1(1)
---->YAB5        ----------->GT1                --------->ARR11(3) --------->ZAT2     --------->ATHB12
 
attacgaaaactgaaatgggaagtgataatcagatagaaggaattgaagaagatttaccagaagcagcagagctcacgcttttctccattgatttctcca  25125100
                                                                            *TSS
                                                                     <---------WOX13(2)
                                                                     --------->WOX13(2)
                                                                 ------>ZmHOX2a(2)
                                                                <------ZmHOX2a(2)
                                                               <---------ARR11(3)
                                                               --------->ARR11(3)
                                                               --------->ARR14(2)
                                                               --------->ARR14(3)
                                                               <-----------ARR10
                       <---------DOF5.7(1)                     <---------ARR14(2)             <-----
                      <---------DOF5.7(1)                      <---------ARR14(3)             ------
                      <----------DOF2                          <---------AGP1            -----------
                      <---------DAG2                           <---------GATA12        --------->At4g35610
   ------->TEIL   <---------TOE2(3)                            --------->RVE1(2)       <---------At4g35610
------->YAB1     <-----------GT1               ----------->GT1 --------->GATA12  <-----------HVH21
 
ttgatgaacttagaaacttttaacgcttttttgttttgtttagactgagagagaaaaaaaactgaagatctcaatttgaaaaactgtgagagcggagaaa  25125200
              --------->YAB1
              <-----------GT1
           <---------ICU4
          --------->ICU4
          <---------YAB1
         --------->AHL25(2)
         --------->AHL20(3)
         <---------AHL25(2)
         <---------AHL20(3)
        --------->YAB1                                                                     <--------
       <---------YAB1                                                                      ---------
   <---------ANAC46                                                                        ---------
----------->HVH21      --------->GLK1(2)                                                   <--------
----GLK1(1)--------->YAB1                                    --------->TOE2(3)            <---------ICU4
--->GLK1(1)--------->YAB5   <---------RVE1(2)      ----------->HVH21 <---------RVE1(2)   --------->ICU4
>GT1 --------->YAB1 ------------>CBF     --------->ARR11(3) --------->REM1(1)            <---------YAB1
 
tctctgacttataataataacaaaacaatctgatttgtttctaagaactcgtggatgacccctacattatttgatatttctcttatagcctcattatttt  25125300
                                                                                            <-------
                                            <---------WOX13(2)                              <-------
                                        --------->At5g28300                                 --------
                                     --------->DOF5.7(1)                                    <-------
                                    --------->YAB1                                          <-------
                                   <---------ATHB12                                         --------
                                <---------------AGL15                                      ---------
                                --------------->AGL15                                      <--------
                               --------------->AGL15                                       <--------
                               <---------------AGL15                                       <--------
                               ----------------->AG                                        <--------
                               ----------------->AGL2                                      ---------
                               --------->MYB46(3)                                          <--------
                               <-----------------AGL1                                      ---------
                               <-----------------AGL2                                      ---------
                               ----------------->AGL3                                      ---------
                               ----------------->AGL1                                      ---------
  <-----------GT1             <-----------------AG                                         <--------
-AHL25(2)                     <-----------------AGL1                        ---------->DOF2---------
>AHL20(3)                --------->ZAT6----------->GT1                 --------->ATHB12    <--------
>AHL25(2)  ----------->HVH21  --------->ANAC46                        --------->ICU4      --------->AHL12(2)
-AHL20(3)<---------ICU4<-----------GT1----------->GT1  --------->ATHB12--------->YAB5     --------->AHL12(3)
 
ctattaaaccaattctgacccattttttactctacccaataagggtaaatttgatgcttcatttgaaattgaattgattaaaagtttaaacaaatttatt  25125400
        <---------AHL25(1)
        <---------AHL12(3)
        <---------AHL20(2)
       --------->AHL20(1)
       <---------AHL20(1)
       --------->AHL25(3)
      <---------AHL20(2)
      --------->AHL12(3)
      <---------AHL12(3)
  --------->AHL20(2)
--AHL25(3)
--AHL12(3)
->AHL20(2)
--AHL25(1)                 <---------AHL20(1)
--AHL20(2)                 --------->AHL20(1)
->AHL25(1)                --------->AHL12(3)
>AHL12(1)            <-------TEIL
-AHL12(3)            <---------YAB5
-AHL12(1)         --------->AHL12(1)
-AHL20(1)         <---------AHL12(1)
-AHL25(1)        --------->ARR11(3)
>AHL25(3)        <---------AHL25(2)
-AHL25(3)        <---------ARR11(3)
>AHL25(1)        --------->AHL12(2)
>AHL12(3)        --------->AHL20(1)
>AHL20(2)        --------->AHL25(2)
>AHL25(2)        <---------AHL20(1)                           ----------->GT1
-AHL20(2)        <---------AHL12(2)                <---------TOE2(3)        <---------ANAC58    ----
>AHL20(1)        <---------AHL20(3)              ---------->DOF2            <---------ANAC58   -----
-AHL25(2)        --------->AHL20(3)             --------->CCA1(2)      --------->TOE2(3)       <----
 
tgagtttatatatatttgaaaatattcatatatattagtttgggaacagagataaaggttttagtatgtaaaaacattagcttgggattaaaaatgaaga  25125500
                                       --------->TOE2(3)
                                       --------->TOE1(3)
                               <---------ANAC55(2)
                               ----------->GT1
         --------->DOF5.7(1)   --------->ANAC55(2)
        --------->DOF5.7(1) --------->GLK1(2)
       ---------->DOF2     --------->KAN4(2)
  <---------TOE2(3)        --------->KAN1
 ---------->DOF2          <---------KAN4(1)                  <---------ANAC58
----->GLK1(1)             <---------KAN1         <-------GAMYB         <<<<<<<<<<E2Fb      <--------
---->ARR11(3)     <----------DOF2      <---------MYB59       <---------ANAC58 <---------MYB46(3)
-----ARR11(3)     <---------DAG2--------->LBD16 <-----------RAV1(1)   ----------->GT1     <---------DOF5.7(1)
 
tttctaaagttaaagggtctactttttgaataatccgtaaaacctaaatttctgttgcagtttgccttgagagcgggaaattggttgaaagtctctttgg  25125600
                                            <---------RVE1(2)
                                           --------->ATHB12
                                         <---------WOX13(1)
                                   <---------GATA12
                                   <---------ARR11(2)
                                   --------->GATA12
                                   --------->ARR11(2)       <---------PCF2
                                   --------->ARR14(2)       <---------PCF5
                              <---------SPL7(1)      <---------KAN1
                              <-----------HVH21      <---------At4g35610                   ---------
                              <---------RAP2.6(3)   --------->GLK1(2)               <---------MYB52(1)
                             --------->DEAR3(1)     <---------GATA12               <-------GAMYB
                            --------->DEAR3(2)     <---------GLK1(2)         --------->ANAC58 <-----
                   --------->KAN1  <---------ARR14(2)--------->At4g35610     --------->ANAC58 <-----
   --------->CCA1(2)        --------->ATERF1(1) <---------TOE2(3)     <-----------GT1--------->WRKY38(1)
--DOF2          ----------->GT1 --------->SPL7(1) <------ZmHOX2a(1) <---------DOF5.7(1)  <----------
 
gagaagatagagagagagagagttactctgagccgtccgattcgattgatttaggaatctgagggacctcatttttccaaacgctccgttgtctgtgggg  25125700
<- Previous    Next ->

AGI:  At5g62550.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G28770.1); similar to unknown [Populus trichocarpa] (GB:ABK92769.1)
Range:  from: 25122802    to: 25125177    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version