AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                     ---------------
                                                                                    <---------ANAC58
                                                                                    <---------------
                                                                                    ----------------
                                                                                --------->At4g35610
                                                                      ---------->DOF2<--------------
                                                                 --------------->AGL15
                                                                 <---------------AGL15
                          --------->DAG2                        ====================================
                <---------GLK1(1)                               ----------------->AGL1
                --------->GLK1(1)                    --------->RVE1(2)--------->DOF5.7(1)
              <------ZmHOX2a(1)                    ------->TEIL ----------------->AGL3
            <---------TOE1(2)  <-----------GT1   --------->YAB5 ----------------->AG<---------ANAC58
       <---------AHL20(2)---------->DOF2        <---------YAB1  ----------------->AGL2<----------DOF2
 
ttaagtgtattttcttaggaattctccaaaaagtttaccaattcatcaactatgaatataaaacgataccaaaaaaagaaaacagttgcctttgatggga  25087800
                                                                                              ------
                                --------->AtMYB61                                            -------
>AGL15              <----------DOF2                                                          -------
--AGL1              <---------DOF5.7(1)                                            --------->HSFB2a(2)
->AGL1             <---------DOF5.7(1)                                             <---------HSFB2a(2)
-AGL15             <---------DAG2                                               <----------DOF2
=MADS_MADS     --------->KAN1<----------ID1  <-----------GT1 <-----------GT1   <---------DOF5.7(1)
 
aaatgaacaaaaactcaaatacccttttcaaaacaccaaaactcattttctctatacttgtatataacaaaacatactcagccctttcagaaacaaaaaa  25087900
                                                                                             ------>ZmHOX2a(2)
                                                                                             <------
                                                                                             -------
                                                                                             =======
                                                                                            <------ZmHOX2a(2)
                                                                                           ---------
                 <----------DOF2                                                           <--------
                 <---------DOF5.7(1)                                                       ---------
                <---------DAG2                                                             <--------
          --------------->AtSPL8                                                           <--------
          --------->YAB5                                                                   ---------
          <---------------AtSPL8                                                           <--------
          <---------ICU4                                                                   ---------
         <---------YAB5                                                                    <--------
       --------->YAB1                                                                      ---------
       <---------ICU4                                          <---------KAN1              ---------
       -------->HAHB4                                         <---------KAN4(2)           <------ZmHOX2a(1)
      --------->ICU4                                      --------->ANAC58              <---------TOE1(2)
     <---------AHL20(3)                              <---------HSFB2a(2)        <---------DAG2
     --------->AHL20(3)            --------->At4g35610  ---------->DOF2         <----------DOF2
    --------->YAB1                --------->ANAC46   --------->HSFB2a(2)     <---------ARR11(3)
--->DAG2 <---------YAB1   <<<<<<<<<TBF1 --------->TOE2(3) --------->ANAC58   --------->ARR11(3)
-->DOF5.7(1)    <---------DOF5.7(1)<---------At4g35610<------NtERF2        --------->DOF5.7(1)<-----
--->DOF2 --------->ICU4<<<<<<<<<TBF1  -------->P  <-----------HVH21      ---------->DOF2<---------TOE2(2)
 
gtagacataataatgagtaccttttcttcttcttcatcagcaacctctaaaaccgtcgggaaaggaattttcataccaaagagctttatcgcaggatctt  25088000
---DOF5.7(1)
-->YAB5
==============================HOX2a_HOX2a
>ARR14(3)
-GATA12
>ARR11(3)     <---------YAB5
-ARR11(3)     <---------TOE2(3)
-ARR14(3)    <-----------GT1       <----------DOF2
>GATA12 <---------YAB1             <---------DOF5.7(1)
-ARR11(2)  <---------YAB1         <---------DOF5.7(1)
>ARR14(2) <---------AHL20(3)   --------->ZAT18     --------->GLK1(2)                <---------LBD16
-ARR14(2) --------->AHL20(3)   <---------ZAT18 <---------TOE2(2)                <----------DOF2
>GLK1(2)--------->ICU4     <---------GATA12    <---------TOE1(2)            <----------DOF2
>ARR11(2)<---------ICU4    --------->GATA12 --------->ANAC46          <----------DOF2
-----DOF2<--------HAHB4------>ZmHOX2a(1)<-----------GT1              <---------DOF5.7(1)      ------
 
tagtttccagcattattatcgttttcctaagatgtgctcttttttactcgtaagtttctgactctctgtgtctcttttcctttcttttcagggtgttttt  25088100
                                                                                                   <
                                                                           <---------RVE1(2)     ---
                                                                     --------->CCA1(2)      ========
                             --------->ALFIN1                       <---------GATA12--------->ANAC55(2)
                         <---------ANAC46                  <---------GLK1(1)   <---------YAB1-------
                    <-----------RAV1(1)       <---------AHL12(1)    --------->GATA12<---------ANAC55(2)
              --------->ARR11(3)              --------->AHL12(1)    <---------RVE1(2)       --------
  <-----------GT1   <---------ANAC46--------->MYB111(1)    *TSS   ----------->ARR10<-------TEIL  <--
--->AHL12(2)  <---------ARR11(3)   <--------P--------->AHL12(2)--------->TOE1(2) <---------RVE1(2) <
 
ttttgtttctcttcgaagatgttttgtggggggtttgggtagtttggaaatttttggtttggaaatcgtgagatttgggattttgatacgttttaaaaag  25088200
           <-----------HVH21
          ==================bZIP_DOF
          --------->bZIP60(2)                                      <----------DOF2
          <---------ZAT2                                        <-----------GT1
          --------->TGA1a                                    --------->AHL12(2)
 --------->ALFIN1                                            <---------AHL12(2)
---------bZIP60(2)                                          --------->AHL12(1)
------>ZAT14                                                <---------AHL12(1)
====================bZIP_DOF         --------->AtMYB61     <---------RVE1(1)
-->DAG2   --------->O2          --------->HSFB2a(2)       <---------RVE1(2)
-->DOF2 <-----------RAV1(2) <---------RVE1(2)         <---------At4g35610    <---------ALFIN1
-------ZAT14           <<<<<<<<<<MYB80         <-----------RAV1(1) <---------DAG2
---------ANAC46  <----------DOF2<---------HSFB2a(2) <---------ANAC46  ---------->ARF1 ---------->DOF2
 
tgaagtggatgccaggtcagcattttggtttgattctagaccacaagtttatgtggcctctgatattttacttttctcccaaaccccattaaaacccata  25088300
                                                                      <---------GATA12
                                                                      --------->GATA12
                                                                      <---------RVE1(2)
                                                                      <---------GLK1(2)         ----
                                                                      <---------ARR11(3)        ----
                                                      <---------AHL20(3)                   <--------
                                                      --------->AHL20(3)                 --------->DOF5.7(2)
                                                      <---------AHL20(2)           <----------DOF2
                <---------AHL20(2)                    --------->AHL25(1)       --------->ZAT14  ----
      <----------DOF2                                 <---------AHL12(3)     --------->ANAC46 <-----
     <---------DOF5.7(1)                             <---------DOF5.7(1)   <-----------GT1--------->WRKY38(1)
    <---------YAB5                                   <---------AHL12(1)    --------->ZAT6<---------MYB52(1)
 <---------AHL20(2)<----------DOF2             --------->GLK1(2)      --------->ARR11(3)<-------GAMYB
 
gcatataatcttttgttattttctttaaactttgtcaaaactattcgaagaatcgatttttttatatgttttagattttcactaaactttccgttaacca  25088400
       --------->DOF5.7(1)
       --------->DAG2
      ---------->DOF2
  <------ZmHOX2a(2)
 <---------GATA12                                                                          ---------
 --------->RVE1(2)                                                             <---------TOE2(1)
-->MYB83--------->DOF5.7(1)                                                    <---------TOE1(1)
-->MYB46(1)                <-------TEIL <-------TEIL                         ------>ZmHOX2a(1)
-DOF5.7(2)--------->ARR11(3)       --------->MYB46(3)           --------->MYB52(1) <------ZmHOX2a(1)
----->MYB52(1)     ----------->GT1 <---------KAN1        --------->YAB5--------->ALFIN1   <---------ATHB12
----MYB59 <---------ARR11(3)  --------->ANAC46           ----------->GT1    --------->TOE1(2)
 
aacagatcaaaaaggtcttatgtagttatatacatggaacaaatgcataacaagtttgaacgataaaaaacgaagtgctcctacgaggatgcaataaagt  25088500
                                                                          --------->RVE1(2)
                                                                          <-----------GT1
                                                                --------->TOE2(3)
                                                              <-----------ARR10
                                     --------->YAB1           --------->RVE1(2)
                      --------->ANAC58                        <---------ARR11(3)
     --------->DOF5.7(1)            <---------AHL20(2)        --------->ARR11(3)
     --------->DAG2   --------->ANAC46              --------->GLK1(1)    --------->AHL20(2)
    ---------->DOF2   --------->ANAC58             --------->ARR11(3)  <---------AHL12(2)
    --------->DOF5.7(1)            --------->AHL20(2)        <---------CCA1(2)
->DOF2       <---------YAB1  <---------MYB52(1)    <---------ARR11(3) --------->YAB5
 
tttcagaaaaagtgtttttataaacacgcttcgttatatataatactgatataagatttctaacatatcttaacaattatctatctattgttgaattgaa  25088600
                                                                                       --------->At4g35610
                                                                                       <---------At4g35610
                                                                                  --------->TGA1a
                                                                                  ==================
                                                                                  --------->O2
                                                                                  <---------O2
                                                                    <---------AtMYB61  <---------ZAT2
                                                                    <-----------RAV1(1)--------->ZAT2
                                                                  ==========================bZIP_DOF
                                       ----------->GT1            <----------DOF2 --------->ANAC58
                                       <------MYB83              <---------ANAC58 --------->ANAC46 -
                                       <------MYB46(1)           <---------ANAC58 --------->ANAC58 <
                                      --------->MYB46(2)<---------ANAC46          <---------TGA1a  <
            <---------ANAC55(2)       --------->MYB111(2) <------NtERF2      ----------->HVH21     <
          --------->YAB1              --------->MYB59   <---------LBD16      <---------ZAT18<-------
         <---------ATHB51             --------->MYB111(1)--------->LBD16   <---------ZAT2   <-------
         --------->ICU4              <---------MYB55(1)<---------LBD16     --------->ZAT2   <-------
       --------->YAB5                <--------P   --------->At4g35610      --------->At4g35610     <
 <---------AHL12(2)           <----------DOF2     <---------At4g35610      <---------At4g35610     <
 
gaaaaaaaaacaattatgtaaactgtttagaaacttttgggtaggtaaatgtcagcatcgcggggatggctttggtgcagctcacacgagagctgtcttg  25088700
<- Previous    Next ->

AGI:  At5g62430.1   
Description:  CDF1 (CYCLING DOF FACTOR 1); DNA binding / protein binding / transcription factor. Identical to Dof zinc finger protein DOF5.5 (DOF5.5) [Arabidopsis Thaliana] (GB:Q8W1E3;GB:Q9FJJ9); similar to CDF3 (CYCLING DOF FACTOR 3), DNA binding / protein binding / transcription factor [Arabidopsis thaliana] (TAIR:AT3G47500.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO64539.1); contains InterPro domain Zinc finger, Dof-type; (InterPro:IPR003851)
Range:  from: 25086319    to: 25088160    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version