AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                     <---------WOX13(2)
                --------->LBD16                <---------------AGL15             --------->YAB1
                --------->HSFB2a(2)            --------------->AGL15       --------->YAB1
                <---------HSFB2a(2)           <---------ANAC58            <---------YAB1
               <---------ANAC46               <---------ANAC46          --------->YAB1
          --------->KAN1                      <---------ANAC58         <---------YAB1
      --------->YAB1                       <---------MYB52(1)         --------->AHL20(3)
     <---------YAB1                       <-------GAMYB               <---------AHL25(2)
    <---------ARR11(3)                --------->GLK1(2)              --------->YAB1               --
    --------->ARR11(3)               <---------GLK1(2)----------->GT1<--------HAHB4  --------->DAG2
    --------->RVE1(2)   <----------DOF2  <-----------RAV1(1)        <---------YAB1  ---------->DOF2
---KAN1  <---------TOE1(2)          --------->KAN1   <---------TOE2(3)<---------AHL20(3)     -------
 
gacataatatcatatgttccgagaatgctttaaaacttcatattctgttgcttgttaatgtaatatgatgtattattatcacaacaataaagtattatct  24976900
                                                                             <---------AHL25(3)
                                          --------->AHL12(3)                --------->AHL25(3)
                                          <---------AHL12(3)                --------->AHL20(1)
                                         <---------AHL20(1)                 <---------AHL12(1)
                             --------->YAB1                                 --------->AHL20(3)
                             <---------ICU4                                 --------->AHL20(2)
                            --------->ICU4--------->AHL20(2)                --------->AHL12(1)
                           --------->AHL12(2)                               --------->AHL25(1)
                           <---------AHL20(3)                               <---------AHL25(3)
                           <---------AHL12(2)                               <---------AHL20(1)
                          <---------AHL25(3)                                <---------AHL25(1)
                          --------->YAB1<---------AHL12(3)                  --------->AHL25(2)
                          --------->YAB5--------->AHL12(3)                  <---------AHL20(2)
                          <---------ICU4--------->AHL25(1)                 --------->AHL25(3)    ---
                         <---------AHL20(2)                               --------->WOX13(2)     <--
                         --------->AHL20(2)                   <---------ARR11(3)   <---------MYB59--
                         <---------AHL25(1)                  --------->CCA1(1)    --------->ANAC55(2)
                         --------->AHL25(1)                  --------->RVE1(1)    <---------ANAC55(2)
                         <---------ATHB12--------->AHL20(1) --------->AHL25(2)--------->WOX13(2)----
                         --------->ICU4 --------->AHL20(2)  <---------AHL25(2)<---------WOX13(2)<---
                         <---------ATHB51<---------AHL25(3)--------->AHL20(3)<---------AHL12(2) <---
                         <---------AHL12(1)         --------->ANAC58      <---------WOX13(2)    ----
       --------->KAN1    --------->AHL25(3) <---------AHL20(2)--------->ARR11(3)<-----------GT1<----
----->TEIL               --------->AHL12(1) <---------AHL12(3)--------->RVE1(2) --------->AHL20(2)<-
-->At4g35610    ----------->GT1<---------YAB1       --------->ANAC58  --------->TOE2(3)     --------
 
gaacgttgcctcattcgtcccgttacaaataattatgtttgaaatatatatatgcaagtcaaaaatatctcattctcaattaattacataactattcaaa  24977000
                                                                                      --------->At4g35610
       --------->ZAT6                                                                 <---------At4g35610
      ------>MYB46(1)                                                              <---------YAB5
      -------->P                                                                  <-----------TGA1
    --------->MYB46(3)                                                            <-----------HVH21
 <-----------GT1                                                                 --------->TGA2(1)
------>AHL12(1)                                                                  --------->ETT(2)
-------AHL12(1)                                                                  <---------ETT(2)
------->YAB1                           <---------KAN4(1)                         <---------TGA2(1)
----->AHL12(2)            <---------DOF5.7(1)                                    <---------bZIP60(1)
------AHL12(2)           <---------DOF5.7(1)                   --------->ANAC46  --------->bZIP60(1)
------AHL20(3)           <----------DOF2                     <---------ALFIN1   <-----------STF1
----->AHL20(3)  >>>>>>>ZML2            --------->KAN1       --------->ZAT14 <---------ICU4
-----ICU4       --------->HSFB2a(2)    --------->KAN4(1)<-----------GT1    --------->ICU4  ------>ZmHOX2a(1)
--------ICU4    <---------HSFB2a(2)------------>CBF    --------->AHL20(2) <---------WOX13(2)
->YAB1------>MYB83      <---------DOF5.7(1)          --------->WOX13(2)   --------->WOX13(2)  ------
 
attatcaccaactctagttctagacttccttttttgtatgcaatattccaaaaactaataaactacacacctagactaattatgtcgtcatctcctaaca  24977100
                                                                 >>>>>>>>>>bZIP19
                                                                 <<<<<<<<<<bZIP23
                                                                 <<<<<<<<<<bZIP19
                                                                 --------->ETT(2)
                                                            <---------ANAC58
                                                            <---------ANAC58
                                                            <---------AtLEC2
                                                        <---------ANAC58
                                                        <---------ANAC46
                                                        <---------ANAC58                       -----
                                                      <---------At5g28300                    -------
                                                     <-----------GT1                         <------
                                                  <---------ICU4 <---------ETT(2)            -------
                                                 --------->ICU4  >>>>>>>>>>bZIP23           <-------
                                    ----------->GT1 <---------YAB1<---------DDF1      --------->ZAT18
                                  ---------->DOF2<---------YAB1 --------->DDF1     <------------CBF
--->ZAT6                    ---------->DOF2   ------->TEIL <-------TEIL       ---------->DOF2-------
 
ctatagcttctaatttcaaaaacaaaattcccaaagtaaaagtaaaatgaacattattaccgtgcatgtcgacattactcccaaagaattgcacaaaatc  24977200
                                                                             ---------->DOF2
                                                                          ----------->RAV1(1)
                                               --------->ZAT18            --------->RAP2.6(2)
                                            <---------MYB46(3)           <----------ID1
                                            --------->KAN1             --------->ANAC46
                                          <-------GAMYB                --------->ANAC58
                                     <---------TGA1a                   --------->ANAC58
                                     --------->TGA1a                 ---------->DOF2
                                     =============MYC_MYB          <---------ATHB12
 --------->ARR14(2)                  ===========================================bZIP_DOF
---->RVE1(2)                         <---------ANAC55(2)           <<<<<<<<<ARR2
-->GATA12                       --------->ANAC46                  --------->RVE1(2)
---ARR11(3)               ----------->TBP--------->MYB52(2)    ------------>CBF                 <---
-->RVE1(2)         <---------KAN1    --------->O2             --------->ANAC46           -----------
--GLK1(2)         --------->GLK1(2)  ===========================================bZIP_DOF>>>>>>>>>TBF1
-->ARR11(3)      <---------GLK1(2)   <---------O2<---------At4g35610--------->YAB1   >>>>>>>>>TBF1
 
tccaaaacctctgtaaacaagaatctcttatatataagaaacgtgagttgttcgctgttacaaacccacaatcaaagccacaaaggaagaagaagaaaaa  24977300
                                        <---------ANAC46
                                        --------->ANAC55(2)
                                        ----------->GT1
                                        <---------ANAC55(2)                         ---------->ID1
                                        <---------ANAC58                            <-----------GT1
                                        <---------ANAC58                           <-----------GT1
                                     --------->GLK1(2)                     <------MYB46(1)
                                    <---------ARR14(2)                     <------MYB83
                                    <---------GATA12                    <---------AtLEC2
                                    --------->GATA12                   <---------ZAT2
                                    <---------GLK1(2)          <---------ANAC58 --------->AHL12(2)
                  ---------->DOF2 ----------->ARR10            <---------ANAC58 <---------AHL12(2)==
    --------->TOE2(3)         --------->YAB5    --------->TOE2(3)      --------->ZAT2  ------>ZmHOX2a(1)
-------ID1<----------DOF2  --------->YAB5--------->LBD16    <----------DOF2----------->GT1        --
>GT1--------->TOE1(3)   <---------DOF5.7(2)---------->DOF2<---------At4g35610   <---------YAB1    <-
 
aaacaaaccctaacttttgtcaaaagtaaacgatgagtagattccgtaaaaccctagtttctgctttcgttctctgcttggttatttttcctcttctagt  24977400
                                   --------->DAG2
                                   --------->DOF5.7(1)
                                 ---------->DOF2
                               ------>ZmHOX2a(2)
                              <------ZmHOX2a(2)
                             --------->GATA12
                             --------->ARR11(2)
                             --------->RVE1(2)
                             <---------GATA12
                             <---------ARR14(2)
                             <---------ARR11(2)
                            <------NtERF2
                           <---------MYB46(3)
                           <---------ATERF1(1)
                          <---------DEAR3(1)
                         <---------LBD16
                         ------>NtERF2
         ============================HOX2a_HOX2a
         <------ZmHOX2a(1)<---------ANAC46              --------->ANAC58
         =============================HOX2a_HOX2a --------->LBD16
      <---------At4g35610<---------At4g35610     <---------ANAC46
      --------->At4g35610<------NtERF2          --------->At4g35610
      <------NtERF2      --------->ATERF1(1)    <---------At4g35610
    =============================RAV  --------->ALFIN1  --------->ANAC58
    <-----------RAV1(2) <---------RAP2.3(1)  <---------ZAT2
   --------->At4g35610 <---------RAP2.3(2)   <---------At4g35610
   <------NtERF2       <---------DEAR3(1)    --------->ZAT2                               <---------
  ----------->RAV1(1)  <---------RAP2.3(3)   --------->At4g35610                      <----------DOF2
<---------At4g35610    <---------RRTF1(3)--------->ARR14(2)                    <------ZmHOX2a(2)
--------->At4g35610    <---------RAP2.6(2)  <-----------RAV1(1)                <---------YAB1
==============RAV      <---------RRTF1(2)<---------ARR14(2)                   --------->ARR11(3)  --
-------->CDC5   >>>>>>>>>MYB2--------->ARR14(2) <---------LBD16               <---------ARR11(3)  <-
----------RAV1(2)    <-----------RAV1(1)<------NtERF2 ---------->DOF2         --------->RVE1(2)   --
 
ctcagcggcagaggaagaaaaccaatgcggcggatccaaaggtggctctgctgcggagaaagcatcggctcttaaatacaagatcatagctttcttttcc  24977500
                                                                                           <--------
                                                                                        --------->DEAR3(1)
                                                                                        --------->ATERF1(2)
                                                                                        <---------RAP2.3(3)
                                                                                        <---------DEAR3(1)
                                                                                        <---------ATERF1(2)
                                                                                       <---------LBD16
                                                                                       --------->ATERF1(1)
                              <-----------------AGL3                                  <---------ATERF1(1)
                   <---------RAP2.6(2)                                                ------>NtERF2
                   <---------ANAC46                                                   --------->ZAT2
             <---------ARR14(2)                                                      --------->DEAR3(1)
             --------->ARR14(2)                                                      ----------->HVH21
         <------NtERF2        <---------MYB59                            --------->REM1(2)--------->RAP2.3(1)
        --------->LBD16       <-----------------AGL2                    ----------->HVH21 <------NtERF2
       --------->DEAR3(1)    --------->ANAC55(2)                      --------->ANAC55(2)--------->LBD16
-DOF2 <---------LBD16<------NtERF2                                    <---------ANAC55(2)------>NtERF2
------->YAB1<---------KAN1 <-----------GT1                           <-------TEIL  <---------At4g35610
--------DOF5.7(1)  <---------ANAC58       <------NtERF2              ------->TEIL  --------->At4g35610
------->TOE2(3)    <---------ANAC58    ---------->ID1      <---------ARR11(3) --------->KAN1  ------
 
atcttaatcgccggagtatttggcgtctgtttacctatttttggcctcaagacggagagcaatttcttcatgtacgtgaaggcattcgctgccggcgtaa  24977600
                                                                                   --------->GATA12
                                                                                   <---------RVE1(2)
                                                                                   --------->ARR11(3)
                                                                                   <---------ARR11(3)
                                                                                   <---------GATA12
                                                                       <---------ALFIN1
               --------->ETT(2)                                       <---------ABI4(2)        <----
      --------->DEAR3(1)                                            --------->ARR11(2)         <----
      --------->DREB2C(2)                                           <---------ARR14(2)         -----
     <------NtERF2 <---------GLK1(2)                                --------->ARR14(2)      --------
     --------->ATERF1(1)                                            <---------ARR11(2)      --------
    <---------ATERF1(1)                                       --------->HSFB2a(2)  <---------GLK1(2)
    --------->MYB52(1)                                        <---------HSFB2a(2)  --------->ARR14(2)
    ------>NtERF2 --------->KAN1                          <---------ANAC58         <---------ARR14(2)
  --------->MYB46(3)       --------->LBD16                <---------ANAC46       ----------->ARR10
  <---------MYB55(2)      --------->HSFB2a(2)             <---------ANAC58  --------->ALFIN1--------
-ANAC46        <---------ZAT18                       <---------ANAC58 --------->MYB46(3)  --------->At4g35610
--->KAN1  <----------DOF2 <---------HSFB2a(2)        <---------ANAC58 <---------MYB55(2)  <---------At4g35610
 
ttctagccaccggctttgtccacattcttcccgatgctaccgagagtctcacgagttcgtgccttggagaagaaccaccgtggggagattttccgatgac  24977700
                                                                                 ---------->DOF2
                                                                               ----------------->AGL1
                                                                      ------>ZmHOX2a(2)
                                                                     <------ZmHOX2a(2)
                                                                    <---------ARR14(2)
                                                                    --------->ARR14(2)
                                                                    <---------GATA12
                                    <---------WOX13(2)              <---------ARR11(2)
                                   --------->ATHB12                 --------->ARR11(3)
                       =============================HOX2a_HOX2a     --------->GATA12
                       ------>ZmHOX2a(2)            <-----------RAV1(2)   <---------ANAC58
                     --------->ARR11(3)      ================================HOX2a_HOX2a
                     --------->GATA12        <----------DOF2        <-----------ARR10
-----bZIP60(2)       <---------GATA12<---------WOX13(1)  <---------KAN1   <---------ANAC58
-----ANAC55(2)       <---------RVE1(2)       ------>ZmHOX2a(1)      <---------ARR11(3)
---->ANAC55(2)       <---------ARR11(3)      ===============================HOX2a_HOX2a
--->TGA1       <------NtERF2    --------->YAB5    <----------DOF2   --------->ARR11(2)            --
--->HVH21   --------->RAP2.6(3) --------->YAB1   <---------ANAC58   <---------AGP1     ----------->GT1
->WRKY12--------------------->WRI1<---------YAB1 <---------ANAC58   --------->AGP1 --------->DOF5.7(1)
 
gggactcgttgccatggctgcatcgatcttgacaatgttgattgaatcctttgcttcagggtatttgaacagatctcgcttggcgaaagagggtaagact  24977800
<- Previous    Next ->

AGI:  At5g62160.1   
Description:  XLG2/ZIP12 (ZINC TRANSPORTER 12 PRECURSOR); cation transmembrane transporter/ metal ion transmembrane transporter. Identical to Probable zinc transporter 12 precursor (ZIP12) [Arabidopsis Thaliana] (GB:Q9FIS2); similar to ZIP5 (ZINC TRANSPORTER 5 PRECURSOR), cation transmembrane transporter [Arabidopsis thaliana] (TAIR:AT1G05300.1); similar to Zrt- and Irt-related protein 12 [Arabidopsis halleri subsp. gemmifera] (GB:AAY29150.1); contains InterPro domain Zinc/iron permease, fungal and plant; (InterPro:IPR004698); contains InterPro domain Zinc/iron permease; (InterPro:IPR003689)
Range:  from: 24977333    to: 24978489    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version