AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                 <---------AHL12(3)
                                                                                 --------->AHL20(2)
                                                                                 <---------AHL20(2)
                                                                                 --------->AHL20(3)
                                                                                 <---------AHL20(3)
                                                                                <---------AHL12(2)
                                                                                --------->TOE2(3)
                                                                                --------->AHL12(2)
                                                                               --------->AHL12(1)
                                                                               <---------AHL12(1)
                                                                              --------->ICU4
                                                                          --------->At5g28300
                                                                         ----------->GT1
                                                                   --------->YAB1--------->AHL25(2)
                      <---------AHL25(3)                           --------->YAB5--------->AHL12(3)
                      <---------AHL25(1)                          <------ZmHOX2a(2)
                    <---------WOX13(2)                           --------->ARR14(2)
              <------ZmHOX2a(1)                                  --------->ARR11(3)
           --------->LBD16                                       <-----------ARR10
          --------->LBD16                                        <---------ARR14(2)
   --------->DOF5.7(1)--------->AHL20(2)           --------->TOE2(3) <---------YAB1
 <---------AHL12(2) --------->WOX13(2)<---------ZAT2             <---------ARR11(3)--------->YAB1
->LBD16 <---------LBD16               --------->ZAT2            <------ZmHOX2a(1)<---------YAB1    -
 
aaaaaaaaaacccccgaggatgaaattaaaacaaataacacagcttgaacaaaacatcaaaaacagaggatcatcacagtaaatattaatacttgaacaa  24861100
                             --------->AHL20(3)
                             <---------YAB1                                                <--------
                             <---------AHL20(3)                                         <---------ANAC58
                             --------->AHL20(2)                                         <---------ANAC46
                             --------->AHL25(2)                                         <---------ANAC55(2)
                            --------->TOE2(3)                                           --------->TGA1a
                            <---------AHL12(2)                                          ============
                            --------->AHL12(2)                                          --------->ANAC55(2)
                           --------->AHL12(1)                                   --------->KAN1
                      --------->At5g28300                                    <---------AHL20(2)
               --------->YAB5--------->AHL12(3)                             --------->AHL20(2)   <--
               --------->YAB1<---------AHL20(2)                          --------->YAB1 <---------ANAC58
              <------ZmHOX2a(2)                                          <---------ICU4 --------->O2
             --------->ARR11(3)--------->AHL20(3)                        <--------HAHB4 <---------O2
             <---------ARR11(3)<---------AHL20(3)          --------->At5g28300 <---------RVE1(2) ---
            <------ZmHOX2a(1)<---------AHL12(3)         --------->ZAT14 <---------ATHB12<---------TGA1a
         --------->CCA1(2) <---------AHL12(1)           <---------ZAT14 <---------YAB5 <---------TOE1(2)
      --------->DOF5.7(1) --------->ICU4           <---------KAN1  --------->TOE2(3) --------->TOE2(2)
    ---------->DOF2  ----------->GT1    ---------->DOF2<---------ALFIN1 --------->ICU4------>ZmHOX2a(1)
-------->TOE2(3) <---------YAB1<---------AHL20(2) --------->RVE1(2)--------->TOE1(3) --------->TOE1(2)
 
aacatcaaaaagataggatcatcacagtaaatattaatatgcataaagaagagaatcaccacagtgaaaaccctaatcattttatattcctacgtgtcaa  24861200
                                                                                               -----
                                                                                               -----
                                                                                               <----
                                                                                               -----
                                                                                               <----
                                                                                       --------->ANAC58
                                                                                       --------->ANAC58
                                                                                       --------->ANAC46
                  <---------ZAT14                                                   --------->ZAT2
                  --------->ZAT14                                                  --------->ANAC58
          --------->ICU4                                                    <---------WOX13(2) -----
     ----------->GT1----------->GT1                                         --------->WOX13(2) <----
<---------YAB1--------->YAB1                                          <------------AtMYB77     <----
---HVH21--------->YAB1                  ---------->DOF2<---------ANAC58  ------------>CBF     <-----
=====================================bZIP_DOF          <---------ANAC58------->GAMYB<---------ZAT2
-------ATHB51<---------YAB5     <---------KAN1 --------->DAG2         <<<<<<<<<TAC1--------->ANAC58
------>ICU4<---------ICU4 ---------->DOF2     ---------->DOF2        --------->ZAT2--------->ANAC46
 
attatgaatggtcataatcagagtagagaaaaagaatgtcgatgaaagaaaaagtttgacttgttaagtcccaactgtcaatttcccagcaagacacata  24861300
                                                                                                  <-
                                                                                               -----
                                                                                           <--------
                                                                                           ---------
      --------->ANAC46                                                                  <-----------GT1
      --------->REM1(1)                                                              <---------AHL12(2)
    <-----------GT1                                                                 <---------AHL12(1)
 <----------DOF2                                                                    <---------AHL25(3)
---->ARR14(2)                                                                       --------->AHL20(2)
---->ARR11(2)                                                                       --------->AHL12(1)
-----ARR14(2)                                                                       <---------AHL12(3)
---->RVE1(2)                                                      --------->RVE1(2) <---------AHL25(1)
-----ARR11(1)                       <------------CBF             <---------KAN1     <---------AHL20(2)
---->ARR11(3)               --------->KAN1                      <---------KAN4(2)   --------->AHL12(3)
-----ARR11(3)           --------->ANAC46    --------->YAB1 --------->DOF5.7(1)     --------->AHL25(3)
-------ARR10     <---------GATA12  --------->ATHB12        ---------->DOF2  --------->TOE1(2) <-----
----CCA1(2)      --------->GATA12<----------DOF2      ----------->TBP----------->TBP--------->AHL25(1)
 
tcttcttttacatcacattacatctacacataaatgctttattgcaaaaatagcgatataaaaaaagaatatacaaaaacctagtatttattttctagat  24861400
                                                         <---------------AGL15
                                                ------------>CBF         --------->DOF5.7(1)
                                               --------->ANAC58    ---------->DOF2
                                    <---------ICU4     <---------At4g35610
   <-----------RAV1(1)             --------->ICU4 --------->WOX13(1)   ---------->DOF2   <---------ZAT6
---------DOF2                   <---------YAB5 --------->ANAC58 ----------->GT1    --------->DOF5.7(1)
---->GLK1(2)                  ----------->GT1 --------->DAG2  --------->DOF5.7(1) --------->DOF5.7(1)
-HSFB2a(2)             <---------ANAC58 ------------>CBF --------------->AGL15   ---------->DOF2
>HSFB2a(2)----------->TBP    --------->ALFIN1---------->DOF2---------->DOF2      --------->DOF5.7(1)
----GLK1(2)            <---------ANAC58<-----------GT1 --------->At4g35610 ----------->GT1
 
tctttactgttgtatatatagaagttgctcgagtggtcatttttacaataaagcaatctgctcaaaagagtaaagaaagagagaaaaagagagtgataga  24861500
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                           <---------TOE1(3)                                                <-------
                        ------>ZmHOX2a(1)                                                   --------
                      ------>ZmHOX2a(2)                  --------->ANAC58                   <-------
                     <------ZmHOX2a(2)                   --------->ANAC58               <---------LBD16
                    <---------GATA12                   --------->ARR11(2)             --------->AtMYB61
                    <---------ARR11(2)                 <---------ARR11(2)             <---------ALFIN1
                    <---------ARR14(2)                 <---------PCF2                 --------->DEAR3(1)
                    ------->TEIL                    --------->ALFIN1                 --------->ZAT2
                    --------->ARR14(2)            --------->LBD16                  --------->DEAR3(1)
                    --------->GATA12            <---------LBD16                    --------->AtMYB61
                    --------->ARR11(2)       --------->KAN4(2)                     <---------ALFIN1
                    --------->ARR11(3)      <----------TaMYB80                 --------->MYB46(3) --
             <---------RVE1(2)              --------->KAN1  ------>MYB83<---------MYB46(3)--------->LBD16
             <---------GLK1(2)            <---------ANAC46  --------->MYB52(1)--------->ANAC58    --
   ----------->GT1  <---------RVE1(2)     <---------ANAC58  ------>MYB46(1)   --------->ANAC46    <-
 ----------->GT1 <---------TOE2(3)        <---------ANAC58--------->MYB46(3)  --------->ANAC58 <----
 
gagagagagaaaaatagattatggatcctgaaggtttcacgagtggcttattccggtggaacccaacgagagcattggttcaagcaccacctccggttcc  24861600
                                 --------->ATERF1(1)
                                 --------->At4g35610
                            --------->DEAR3(1)
                          --------->ZAT14
                          --------->LBD16                                              --------->ARR14(2)
                   ----------->HVH21                                                   <---------ARR14(2)
        <---------At4g35610 ----------->HVH21                                          <---------ARR11(2)
     --------->ZAT14      --------->At4g35610                                      --------->ANAC58
     --------->At4g35610--------->ANAC58                                           --------->ANAC58
     <---------At4g35610--------->ANAC58                                          --------->SPL1(2)
  ----------->RAV1(2) <---------bZIP60(1)                                         --------->SPL7(1)
  ====================RAV--------->DEAR3(1)                                      --------->SPL1(1)
  --------->At4g35610 --------->bZIP60(1)                                        <---------SPL1(1)
  <---------At4g35610 <---------ALFIN1                                           <---------MYB52(1)
  --------->LBD16 <-----------HVH21                                             <---------SPL1(2)
--ARR11(2)       --------->At4g35610                                            <---------SPL7(1)
--TCP16(1)   ------->GAMYB<---------At4g35610                                  <---------ANAC58
->ARR11(2)  <---------MYB55(2) <---------DEAR3(1)                              <---------ANAC58   <-
--ARR14(2)=============================RAV                                    <---------------AtSPL3
->ARR14(2)----------->RAV1(1)<---------ATERF1(1)                              --------------->AtSPL3
--TCP20 --------->At4g35610<-----------RAV1(2)                            --------->MYB59        <--
------->DEAR3(1) --------->LBD16 <---------At4g35610                   <---------ARR14(2)    -------
------->AtMYB61  ----------->GT1<---------ATERF1(1)                   --------->KAN1   --------->ARR11(2)
--------ALFIN1  <---------DEAR3(1)    <----------DOF2      <---------ANAC46  <------------------SPL14
-----ALFIN1 --------->MYB46(3)--------->RAP2.6(3)        <---------MYB46(3) ------------------>SPL14
 
acctccgctgcagcaacagccggtgacaccgcagacggctgcttttgggatgcgacttggtggtttagagggactattcggtccgtacggtatacgtttc  24861700
      <---------ANAC46
     <------NtERF2
     --------->ATERF1(1)
     --------->RAP2.3(1)
    <---------ERF1
    <---------ORA47(2)
    ------>NtERF2
    <---------RAP2.3(1)
    <---------ATERF1(1)
    <---------DEAR4(2)
   <---------RRTF1(3)
   --------->DEAR3(1)
   <---------DEAR3(1)                  --------->ANAC58
   <---------ANAC46                    --------->ANAC58
   <---------RAP2.3(3)       <---------LBD16 <---------ANAC46
   <---------RAP2.3(2)       <---------At5g28300                                                  <-
  <---------ABI4(1)    <------MYB46(1)<---------ZAT18                                          -----
 <---------ATERF1(1)   <------MYB83 <---------ZAT2            <------ZmHOX2a(1)--------->YAB5  -----
--------->ANAC46      --------->MYB59 --------->ZAT18       --------->ALFIN1  <---------YAB1   <----
--------ALFIN1--------->At4g35610   --------->ZAT2        <---------TOE2(1) --------->YAB5     <----
-------REM1(2)<---------At4g35610  --------->ANAC58       <---------TOE1(1)--------->ICU4     <-----
-->ARR11(2)  --------->MYB52(1)    --------->ANAC58     <------ZmHOX2a(1)--------->CCA1(2)  --------
 
tacacggcggcgaagatagcggagttaggttttacggcgagcacgcttgtgggtatgaaggacgaggagcttgaagagatgatgaatagtctctctcata  24861800
         <---------HSFB2a(1)
         --------->HSFB2a(1)            <---------At4g35610
         <---------ZAT2                 --------->At4g35610
         <---------At4g35610            <---------ZAT2
         <---------HSFC1(2)   --------->ANAC58                                                  <---
         --------->HSFC1(2)   --------->ANAC58                                                  <---
     <---------MYB46(3)      --------->SPL1(2)                                             ---------
   <---------MYB52(1)    <---------------AtSPL3                                            <--------
  <-------GAMYB          --------------->AtSPL3                                            <--------
 <---------ANAC58      <---------DOF5.7(2)       ---------->DOF2                           ---------
 <---------ANAC58      --------->MYB52(1)      <---------MYB52(1)                         --------->GLK1(2)
---------DOF2         <---------WRKY38(1)  ------>NtERF2--------->MYB52(1)                <---------KAN4(2)
---->ARR11(3)      <---------MYB46(3)   --------->ZAT2----------->HVH21                   --------->ARR14(2)
---->RVE1(2)       <------MYB83----------->GT1<-----------HVH21  --------->ATHB12       <------ZmHOX2a(1)
-----ARR11(1)      <------MYB46(1)   ---------->DOF2<---------At4g35610             --------->DOF5.7(1)
-----ARR11(3)    <--------P<---------SPL7(1)  <-------GAMYB  --------->ARR11(2)   <------ZmHOX2a(1)
----CCA1(2)    <-----------RAV1(1)--------->RVE1(2) --------->At4g35610    --------->DOF5.7(1)  ----
->YAB1   --------->At4g35610 --------->SPL7(1)<---------RAP2.6(3)--------->YAB5<------ZmHOX2a(1)----
 
tctttcgttgggagcttcttgttggtgaacggtacggtatcaaagctgccgttagagctgaacggagacgattgcaagaagaggaggaagaggaatcttc  24861900
                                                                                     <---------YAB1
     <---------MYB52(1)                                                            <---------ICU4
     <------NtERF2                                                                 -------->HAHB4
    ------>NtERF2                                                                  --------->YAB1
    <-----------HVH21                                                             --------->ICU4
    <---------RAP2.6(3)                                                          <---------AHL12(2)
   --------->DEAR3(1)                                                            --------->AHL12(2)
   --------->RAP2.3(2)                                                           <---------AHL20(3)
   --------->RRTF1(3)                                                           <---------ICU4
   --------->RAP2.3(3)                                                          <--------ATHB1
   --------->RAP2.6(2)          <---------ARR14(2)                              --------->YAB5
  <------NtERF2                 --------->ARR11(2)                              --------->ATHB51
  --------->RAP2.3(1)           <---------ARR11(2)                              <--------HAHB4
 <---------ATERF1(1)          --------->KAN1                                    --------->YAB1
 ------>NtERF2          --------->At4g35610                                    --------->ICU4
--------->ANAC46        ------>NtERF2                                          <---------ATHB12
------HSFC1(1)          <---------At4g35610    --------->ANAC58                --------->AHL20(2)
------HSFB2a(2)        --------->DEAR3(1)      --------->ANAC58                --------->AHL25(3)
>HSFC1(2)             --------->RAP2.3(1) <---------ICU4                       <---------ATHB51
-HSFC1(2)            --------->LBD16 <---------MYB52(1)                    <-------TEIL
-HSFB2a(1)           <---------ATERF1(1)  --------->YAB1                ----------->GT1
>HSFB2a(1)           ------>NtERF2<---------LBD16                      <---------------AtSPL8
----->HSFB2a(2)     --------->ANAC46--------->LBD16                    --------------->AtSPL8   ----
----->HSFC1(1)      --------->DEAR3(1)   <---------YAB5         <-----------------AGL1--------->YAB5
 
tagacgccgtcatttgctactctccgccgctggtgattccggtactcatcacgctcttgatgctctctcccaagaaggtacaataattatgaatacatat  24862000
<- Previous    Next ->

AGI:  At5g61850.1   
Description:  LFY (LEAFY); transcription factor. Identical to Protein LEAFY (LFY) [Arabidopsis Thaliana] (GB:Q00958;GB:Q8LSH2;GB:Q8LSH3); similar to LEAFY transcription factor [Brassica juncea] (GB:ABF06559.1); contains InterPro domain Floricaula/leafy protein; (InterPro:IPR002910)
Range:  from: 24861521    to: 24864159    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version