AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                          ------>ZmHOX2a(1)
                        ----------->RAV1(2)
                      ------>ZmHOX2a(2)                    <---------YAB1
                      ==================================HOX2a_HOX2a
              ===================HOX2a_HOX2a              <---------ARR11(3)
              <------ZmHOX2a(2)                          --------->YAB1                      <------
             <---------ARR11(3)                ----------->RAV1(2)                --------->YAB5
             --------->RVE1(2)      --------->ANAC58    --------->ICU4          <---------WOX13(1) <
             --------->ARR11(3)<---------ARR11(2)------>ZmHOX2a(1)<---------AHL20(2)        --------
<-----------ARR10    <---------GLK1(1)    <---------ICU4<---------YAB1     --------->DOF5.7(1)------
------At4g35610     <---------GATA12--------->ANAC46    <---------YAB5   ---------->DOF2--------->At4g35610
----->At4g35610     --------->GATA12--------->ANAC58  --------->YAB1---------->DOF2     <---------At4g35610
 
gcagaactaagcacaagatcatcgatctcctgtggtaacgagccatcatctcctgtttcatgatcatatataaaaggaaagagattgattcagctaatca  24853500
                                                                                      --------->YAB1
                                                                                 --------->AHL12(3)
                                                                                 --------->AHL20(2)
                                                                                 <---------AHL20(2)
                                                                                 <---------AHL25(1)
                                                                                 <---------AHL20(3)
                                                                                 --------->AHL25(2)
                                                                                 --------->AHL20(3)
                                                                                 --------->AHL25(1)
     <---------YAB5       --------->RVE1(2)                                     --------->YAB1
--------->YAB1   <---------GLK1(1)                                           ------>MYB83
---ATHB12        --------->GLK1(1)                                         --------->TOE2(3)--------
-------TEIL     <---------ARR11(3)                              --------->MYB46(3)   <---------YAB5
->RVE1(2)       --------->ARR11(3)  ------>MYB46(1)          <---------KAN1<---------MYB59  <-------
--->YAB1   <---------RVE1(2)        ------>MYB83           <------ZmHOX2a(1) ------>MYB46(1)<-------
 
aattcataaacatggataagatatcacaaactctaaacctagctcaaactatgaacaatagaggataaccacttgaaacctaattttaatcagaagattt  24853600
                                                                        --------->RVE1(2)
                                                                        ------->TEIL     <---------DOF5.7(1)
                                                                        --------->ARR14(2)   -------
                                                                        <---------ARR14(2)   <------
      <---------At4g35610                                               --------->ARR11(2)   <------
     <-----------RAV1(1)                              <---------DAG2 <---------KAN1    --------->GLK1(2)
 <---------ANAC58                                     <---------DOF5.7(1)<-----------------AGL1
 <---------ANAC58        <----------DOF2            -------->P--------->DOF5.7(1)    --------->KAN4(1)
->ARR11(3)      --------->YAB1                     <-----------GT1  ------->TEIL     <---------KAN4(1)
--ARR11(3)  --------->KAN1               --------->DAG2     ---------->DOF2         <---------KAN4(2)
--GATA12 <---------At4g35610            ---------->DOF2<----------DOF2  <---------ARR11(2)   -------
 
tagtacttgtgctgcttattcaaaattcctttgcccaaaaaaaaaaagtttgacttaccttttgaaagacgaacgtatccactatggaacaatctttcgt  24853700
                                                 <---------AHL25(3)
                                                --------->AHL12(1)
                                                <---------AHL12(1)
                                                <---------AHL20(2)
                                                --------->AHL12(3)
                                                --------->AHL25(3)
                                                --------->AHL25(2)
                                                <---------AHL12(3)
                                                <---------AHL25(3)
                                                <---------AHL25(1)
                                                --------->AHL20(2)
                    <---------AHL20(2)          --------->AHL25(1)
                  <---------WOX13(2)          <---------WOX13(2)
              <------MYB46(1)                 --------->WOX13(2)           --------->LBD16
    <----------DOF2 --------->AHL20(2) <---------WOX13(1)           ------>ZmHOX2a(1)
-->ANAC55(2)  <------MYB83            <---------RVE1(2)            --------->TOE2(3)       ---------
---ANAC58     ----------->GT1         >>>>>>>>>ARR2             --------->GLK1(2)  <---------WOX13(2)
---ANAC58    --------->MYB46(2)     <---------AHL20(2)         <---------GLK1(2)   --------->WOX13(2)
-->YAB1      --------->MYB59        <---------YAB1            --------->KAN1  --------->GLK1(1)
 
aatctcactttctagtttggtatttaaaaaacccaaaatttgattgtcaaattaaatacaataagagattcctaaacccagaattcaattgcgaaatcaa  24853800
                                                                        --------->HSFC1(2)
                                                                        <---------HSFB2a(1)
                                                         --------->GLK1(2)
                                                         --------->ARR14(2)
                                                         <---------ARR14(2)
                                              <---------ANAC58          <---------HSFC1(2)
                                              <---------ANAC58 <---------KAN1<---------HSFC1(1)
                                              <---------ANAC55(1)   ----------->GT1
                                              <---------ANAC55(2)  --------->ANAC46     <---------KAN1
                                              --------->ANAC55(2)--------->MYB52(1)  --------->LBD16
                                              <---------ANAC46--------->ARR11(2)   <---------LBD16--
                                            <-----------GT1 ----------->GT1  --------->HSFB2a(2) ---
     <---------ARR14(2)                   <----------DOF2------->TEIL   --------->HSFB2a(1)  <------
     <---------ARR11(2)                <---------YAB5    <---------ARR11(2)  --------->HSFC1(1)  ---
>RVE1(2)                             ----------->GT1     --------->ARR11(2)  <---------HSFB2a(2)<---
 
acagagacgatacagagagagcgagagagcgagagagagagagtgatttacgtgagaacgaatcggataaacggaaatttccagaagccggatgagtttc  24853900
          ----------->GT1
         --------->YAB5                                --------->RVE1(2)
        <---------YAB1                            <---------YAB1                                  --
        --------->ICU4                            ------------>CBF                      --------->GLK1(2)
     <---------YAB1                           --------->ANAC55(2)                      <---------GLK1(2)
   --------->YAB1                       --------->AHL25(3)                       --------->ANAC58 <-
<----------DOF2                <-------GAMYB  <---------ANAC55(2)         <---------SPL7(1)---------
------->LBD16               --------->LBD16  <---------ICU4              <---------ANAC55(2)      <-
------>LBD16              <---------LBD16<---------AHL25(3)              --------->ANAC55(2)<-------
---ARR11(2)            --------->ARR14(2)<---------AHL20(2)              <---------ANAC46<---------YAB5
------>ANAC46         --------->KAN1    --------->AHL20(2)              <-----------------------TaNAC69(2)
------LBD16        *TSS<---------ARR14(2)<---------AHL25(1)     ------->TEIL     --------->ANAC58 <-
 
ccgctattgtgatgagtaacaaaacaaattcgggagttgtctatttaatacttatcaatagcccatgaacgcagagacgtatggacgcgagaatcgttag  24854000
                                 <-----------HVH21
                                --------->TGA1a
                                <---------TGA1a
                                <---------O2
                      ----------->HVH21
                      --------->TGA2(2)
                     <-----------HVH21
                    <---------bZIP60(2)
                    --------->bZIP60(2)
                    --------->ANAC58
      <-------MYC3  <---------ANAC58
      ------->MYC3  --------->ANAC58
      ------->MYC4  <---------ANAC58
      ------->MYC2  --------->O2--------->bZIP60(1)
      <-------MYC2  <---------O2--------->ANAC46
      <-------MYC4  --------->TGA1a
     =========================bZIP_bZIP
     <---------O2   --------->ANAC55(2)
     --------->TGA1a--------->bZIP60(1)
     --------->O2   <---------bZIP60(1)
     <--------ABF1  <---------ANAC55(2)
     --------->ANAC55(2)        --------->O2
     <---------ANAC55(2)   --------->ZAT14
     <---------TGA1a--------->TGA2(1)                                                  <------MYB83
     <---------ANAC46<-----------TGA1                                                  <------MYB46(1)
 <-----------HVH21  <---------TGA2(1)                                           --------->YAB1
----------->HVH21   ======================bZIP_bZIP                             <---------ICU4
------->ANAC55(2)   <---------TGA1a                      ------>ZmHOX2a(1)     <---------ATHB12-----
--------ANAC58     <-----------STF1        --------->ANAC46               --------->ANAC58   -------
>TOE2(3)--------->REM1(2) --------->DEAR3(1) <---------MYB52(1)           --------->ANAC58  <-------
--------ANAC55(2)  ----------->STF1        --------->ANAC58        <-----------GT1<---------YAB1
--MYB52(1)       ----------->TGA1<-----------TGA1     ---------->ID1      --------->ANAC46  <-------
--------ANAC58   ----------->HVH21         --------->ANAC58       <---------AHL20(2)  --------->MYB59
 
tacgtgacacgtgtaaaccagtgacgtcaccgctctcgtcacaaacccgctagtattgtcctcttctattttatctcacacaatcatgttaggttatcat  24854100
                                                    --------->AHL20(2)               <---------AHL20(2)
                                         ------->GAMYB                               --------->AHL20(2)
                                         --------->DEAR3(1)                          <---------AHL25(3)
                                         --------->TOE2(2)                           <---------AHL25(1)
                                        <---------MYB55(2)                           --------->AHL25(1)
                                        --------->DEAR3(2)                         <---------AHL12(2)
 --------->ZAT6                         --------->MYB46(3)                         <---------WOX13(2)
---------->AtSPL8                     --------->MYB52(1)                           --------->WOX13(2)
-->YAB1                       --------->KAN1 ------>NtERF2           <---------RVE1(2)
--YAB1                       <---------RVE1(2)      <---------AHL25(3)--------->CCA1(2)
--YAB5 <---------YAB5      ----------->GT1  <---------ETT(2)  ---------->DOF2    --------->AHL20(2)
 
agtaccactaaacatttatgtgagaatggatggatattagacaaccgacgacaaataaaacaaacaaaagtagatagacgaccataaattaaactataaa  24854200
                           <---------RVE1(2)
                           --------->GATA12
                           --------->ARR11(3)
                           <---------GATA12
                           <---------ARR11(3)
                           <---------GLK1(2)
                <---------ICU4
                --------->ATHB12                                                   <---------ANAC46
                -------->ATHB1                                               <---------AHL20(2)    <
                --------->YAB5             <---------ANAC46                  <---------AHL25(3)-----
               <---------YAB1              <---------ANAC58                  <---------AHL25(1)<----
               <---------YAB5              <---------ANAC58                 --------->ICU4     -----
            --------->AHL12(1)           --------->ARR11(3)                 <---------YAB1     -----
            <---------AHL12(1)      <---------KAN1     <-----------GT1     --------->WOX13(2) <-----
       ----------->GT1   ----------->ARR10 ----------->GT1                 <---------WOX13(2) <-----
 
cgaagattgagggaaaaaatcattggtttagattttcgaacaaatatcgtgaaaagtttttcatcttgtagtttttgtaattaatggtgtatgaaaaatc  24854300
                            <---------DOF5.7(2)
                            --------->MYB52(1)
                           <---------WRKY12
                  --------->AHL12(2)
                  <---------AHL12(2)
                 <---------AHL12(3)
                 <---------AHL25(3)
                 --------->AHL25(1)
                 --------->AHL25(2)
                 <---------AHL25(1)
                 --------->AHL20(1)
                 --------->AHL25(3)
                 <---------AHL20(2)
                 --------->AHL20(2)
                 --------->AHL12(3)
                 <---------AHL25(2)                         <---------ARR11(3)
                <---------AHL20(2)                          <---------GATA12
                --------->AHL20(2)                          --------->ARR11(1)
                <---------AHL25(2)                      --------->YAB1
                --------->AHL25(3)                      ---------->DOF2                      <------
                <---------AHL25(1)                     <---------ATHB12                      >>>>>>>
                <---------AHL12(3)                    --------->WOX13(2)                     >>>>>>>
                --------->AHL12(3)                    <---------WOX13(2)                     >>>>>>>
---------MYB46(3)<---------AHL20(1)                <---------ATHB12                          >>>>>>>
---->ATHB12     <---------AHL25(3)                --------->ANAC58                      <---------ANAC46
-----ICU4       --------->AHL25(1)                --------->ANAC46                     <---------MYB46(3)
--->ATHB1     <---------WOX13(2)                  --------->ANAC58                     <-----------RAV1(1)
---->YAB5     --------->WOX13(2)                 ------>MYB46(1)                      <---------ANAC46
----YAB1 <---------WOX13(2)--------->ZAT14       ------>MYB83--------->CCA1(2) <---------ANAC46
----YAB5 --------->WOX13(2)<---------ZAT14   ------->TEIL <---------YAB5     <---------ARR11(2)
 
attggtttgtttagttgaattaaatttcagtaaacggtttagagtatgaacccactcaataaagatttgactgccaagcgttactggtgtctggtggatt  24854400
<- Previous    Next ->

AGI:  At5g61820.1   
Description:  similar to MtN19-like protein [Pisum sativum] (GB:AAU14999.2); contains InterPro domain Stress up-regulated Nod 19 (InterPro:IPR011692)
Range:  from: 24851543    to: 24853920    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version