AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                   --------->GLK1(2)
                   --------->RVE1(2)
                   <---------ARR11(3)
             --------->ANAC58
             --------->ANAC46
           ------>MYB83
           ------>MYB46(1)
           --------->MYB52(1)
        --------->MYB46(3)
      --------->WOX13(1)
    <---------YAB5 --------->GATA12
    <---------ATHB12
------->ZAT6 --------->ANAC58                     <---------WOX13(2)              --------->DOF5.7(1)
----->KAN1--------->MYB55(1)                 ------->TEIL                       ---------->DOF2 ----
---ZAT6-------->P  <---------GATA12       <---------YAB1             --------->ARR11(2)       ------
--TOE2(3)--------->AtMYB61         <----------DOF2--------->WOX13(2)------>ZmHOX2a(1) ---------->DOF2
--TOE1(3)------->GAMYB            <---------DOF5.7(1) <---------TOE2(3)   --------->ANAC46----------
 
tactctaatcaaccaaacgcaaaatctaaaaatagtgtctttcttatgaatcaaattagggttcttcaatcctttccacataaaaaagagaaagaaagaa  24832300
                                                               --------->ANAC58
                                                               <---------ANAC55(2)
                                                               --------->ANAC58
                                                               --------->ANAC55(2)
                                                          --------->DAG2
                                                          --------->DOF5.7(1)
                           <---------ANAC58              --------->DOF5.7(1)
                   --------->YAB1     --------->DEAR3(1) ---------->DOF2
        ------>MYB83   --------->GLK1(1)               --------->AHL20(2)              --------->ANAC46
        ------>MYB46(1)<---------GLK1(1) --------->DEAR3(1)--------->DOF5.7(1)         --------->ANAC58
------->GT1     --------->WOX13(1)<-------TEIL         --------->YAB1                  --------->ANAC58
---->DOF2<---------ATHB12  --------------------->WRI1  <---------AHL20(2)          <-----------HVH21
>DOF2  --------->WOX13(1)  <---------ANAC58      ----------->GT1                --------->LBD16    -
 
agaaaaaaaccaatcaagtctatcagaattccttgagttcatcgccgaagaagagtaataaaaagcgcgtaatgaaacaatcccagagtcacaccatgac  24832400
                          --------->ZAT18
                         <---------ANAC58
                         ----------->GT1
                         <---------ANAC58
                ------>ZmHOX2a(2)
               --------->GLK1(1)
               <------ZmHOX2a(2)             <----------DOF2
              <---------ARR11(3)  ----------->GT1
              <---------GATA12   --------->DAG2
              --------->GATA12   --------->DOF5.7(1)                               --------->MYB52(1)
   <-----------GT1      <-----------------------TaNAC69(2)   <---------ICU4        <-----------GT1
 --------->AHL20(2)     <---------------AtSPL8              <---------YAB5     --------->DAG2
<---------AHL12(2)   ---------->DOF2   ---------->DOF2   <---------KAN1       ---------->DOF2     <-
-------->YAB1 --------->ARR11(3)---------->DOF2   <---------RVE1(2)     <----------DOF2 <---------GLK1(1)
 
aaaaataaacaatttgagatctctaaaagcgtacaaaaagtgaaaagtctttagattagaataaacattgtggaactttagaaaagtaacgatttctggt  24832500
                                                                                     --------->GATA12
                                                                                     --------->RVE1(2)
                                                                                     --------->ARR14(2)
                                                                                     <---------ARR14(2)
                                                                                     <---------GATA12
                                                                                     <-----------ARR10
                                                                                ------>MYB46(1)
                                                                                ------>MYB83
                                                                              <---------MYB46(2)
                                                                              <---------MYB59
                                                                       --------->AHL20(1)
                                                                       <---------AHL20(2)
                                                                       --------->AHL25(3)
                                                                       <---------AHL25(2)
                                                                       --------->ARR11(3)
                                                                       <---------ARR11(3)
                                                                       --------->AHL25(2)
                                                                       --------->AHL20(2)
                                                                       <---------AHL25(3)
                                                                       --------->AHL12(1)
                                                                       <---------AHL12(1)
                                                                       <---------AHL20(1)
                                                                       <---------AHL25(1)
                                                                       <---------AHL20(3)
                                                                       --------->AHL25(1)
                                                                       --------->AHL20(3)    -------
                                                                      --------->AHL12(2)    --------
                                   <----------DOF2                    <---------AHL12(3)    --------
       --------->AHL12(3)       <---------ARR11(3)                    --------->AHL12(3)   ---------
       --------->AHL12(2)  --------->ANAC46 <---------TOE2(3)         --------->AHL25(1)   ---------
   <---------ANAC55(2) ----------->RAV1(1)---------->DOF2   ---------->DOF2<-----------GT1 <--------
--------YAB1 <---------AHL20(2) --------->ARR11(3)        <---------YAB1<---------AHL12(2) <--------
 
gataatacataaatattgaattggagcaacacgaagaactttgctcaaaggtaagagatttatcaaagaagaaatatattaccaaacaaatctccccgga  24832600
                                                                       -------->P
                                                                   --------->ANAC58
                                                                   --------->ANAC58
                                                          <---------AHL25(2)
                                                          <---------AHL12(1)                <-------
                                                          --------->AHL25(2)               <--------
<---------AHL12(1)                                        --------->AHL12(1)              --------->AHL20(2)
--------->AHL12(1)                                        --------->AHL20(2)    <------NtERF2
-->LBD16                                    <---------WOX13(1)     --------->ANAC46       <---------KAN1
->ANAC46                                   <---------ANAC58<---------AHL12(1)  <---------HSFB2a(2)
->LBD16                                    <---------ANAC58--------->KAN1      --------->HSFB2a(2)
>HSFB2a(2)                                --------->ATHB12--------->AHL25(1)  <---------ANAC46
>LBD16 <---------At4g35610               <---------YAB1   --------->AHL20(3)  <---------LBD16
-HSFB2a(2)                           <---------YAB5       <---------AHL25(1)  --------->ETT(1)   ---
-LBD16<---------RVE1(2)              --------->ICU4 --------->AtLEC2*TSS    <-----------HVH21  -----
 
gaaatttttgagatgctcaaacgatagcaaaataagtgtaattgttgattgttctatgcaaaaaattcccaagcaaccttgtcgggaagacgaataaata  24832700
                  <---------WOX13(2)
                  <------------CBF
                  --------->WOX13(2)
                 --------->ATHB51
                 <--------ATHB1
                 --------->ATHB12
                 <---------ICU4
                 -------->HAHB4
                <---------YAB5
                <---------ATHB51
        <---------AHL20(2)
      <---------WOX13(2)
      --------->WOX13(2)
      <---------AHL12(2)
     --------->AHL20(3)
     --------->AHL25(1)
     <---------AHL25(3)
     <---------AHL20(3)
     --------->AHL25(2)
     --------->AHL20(2)
     --------->AHL12(3)
     <---------AHL12(3)
     <---------AHL20(2)
    <---------AHL20(2)
    <---------AHL12(3)
    --------->AHL12(3)
    --------->AHL25(3)
    <---------AHL25(3)
    --------->AHL20(2)
    --------->AHL12(1)
    <---------AHL25(2)
    <---------AHL20(1)   <---------AHL25(3)
    --------->AHL20(1)   --------->AHL20(2)
    --------->AHL25(2)   <---------AHL12(1)
    <---------AHL12(1)   --------->AHL12(1)
    <---------AHL25(1)   --------->AHL25(3)
    --------->AHL25(1)   <---------AHL20(2)
   --------->AHL25(3)    --------->AHL25(2)
   <---------AHL12(3)    <---------AHL20(1)
   --------->AHL20(2)    <---------AHL25(2)
   --------->AHL25(2)    <---------AHL25(1)
   <---------AHL25(2)    --------->AHL25(1)
   <---------AHL25(1)    <---------AHL20(3)                                  <------------CBF
   --------->AHL12(3)    --------->AHL20(3)                                  --------->ARR14(2)
   --------->AHL25(1)    --------->AHL20(1)                   <---------ARR11(2)
  <---------WOX13(2)    --------->AHL20(2)                    --------->ARR11(2)
  --------->AHL12(2)    --------->AHL25(3)             ---------->DOF2     --------->LBD16
  <---------AHL12(2)--------->AHL20(2)                 <---------ZAT14   <---------LBD16
--AHL12(2)      --------->ICU4              <------------CBF  <---------ARR14(2)
-AHL25(3)       <---------YAB1            --------->DOF5.7(1) --------->ARR14(2)        --------->MYB52(1)
-------->GT1  --------->YAB1       <---------TOE2(3)   --------->ZAT14  ------->TEIL   --------->KAN1
----->DOF2 --------->ANAC55(2) <----------DOF2     --------->YAB5    <---------KAN1 <---------ZAT6
 
aagaaaattaatttaagtaataattgaataaattctttatggaaaaagattgaatcactaaaccggacccgaatgaaccggattgtagagataaccggtt  24832800
                                                    --------->TOE2(3)
                                                  ------>MYB46(1)                         <------MYB83
                                                  -------->P                              <---------ANAC55(2)
                                                  ------>MYB83                            ----------
                                                 ------>ZmHOX2a(1)                        <------MYB46(1)
                                                <---------MYB111(2)             <---------WOX13(2)
                                               --------->TOE1(1)                --------->WOX13(2)
                                            <---------At4g35610            <------NtERF2  --------->ANAC55(2)
                                          <---------ALFIN1                 --------->RAP2.3(1)
                                         <------NtERF2                    --------->LBD16--------->MYB46(2)
                                        <-----------HVH21                 ------>NtERF2  --------->MYB59
                                        <-----------TGA1                  <---------ATERF1(1)
                                        <---------RAP2.6(3)              <---------ATERF1(2)
                                        <---------ATERF1(1)              <---------DEAR3(1)
                                       --------->RAP2.3(2)               --------->DEAR3(1)     <---
                                       --------->RAP2.6(2)               --------->ATERF1(2)    ----
                                       --------->ANAC46                 --------->SPL7(1)--------->MYB111(1)
            <------NtERF2              --------->DEAR3(1)               --------->ATERF1(1)    -----
          <---------ANAC58             --------->RAP2.3(3)             ------>NtERF2 <---------ZAT6-
          <---------ANAC58           --------->At4g35610              <---------SPL7(1) <---------MYB55(1)
  <---------AHL25(3)             *TSS<---------At4g35610              ------>NtERF2 <---------TOE2(3)
 --------->AHL20(2)       <-----------GT1<---------MYB52(1)         <---------LBD16 <---------TOE1(3)
 
ttgaataaatagggcgtcttcatcagtttttacaaaattcagccgtcacctcctacctcagactctattactccggccggcgaaattagggttaggtaat  24832900
->GT1                  <----------DOF2
------ICU4             <---------DAG2
----->YAB1            <---------DOF5.7(1)                                   <---------At4g35610
---->ICU4  <---------KAN1                                            <---------WOX13(2)
-------->YAB5   <-----------GT1<---------YAB5                        --------->WOX13(2)            -
 
aatctctacttcgagtgtattactctctttttgagtcatccatggtttttggtatctatctgtagaagccctaatttagagctcattcactctcaagggt  24833000
                                                              <-----------GT1
                                                     --------->ARR14(2)                   <------MYB83
                                                     <---------ARR11(2)                   <---------ANAC46
                                                     ------>MYB46(1)                      <------MYB46(1)
                                                     <---------ARR14(2)                  <---------MYB46(3)
                                                     ------>MYB83            <---------KAN1
                                                <-----------GT1             --------->GLK1(2)
                                             <---------ARR11(2)             --------->ARR14(2)
                                      <----------DOF2--------->ARR11(2)     <---------ARR14(2)
             <----------DOF2         <---------DOF5.7(1)    <---------DOF5.7(1)          --------->MYB46(2)
            <---------ANAC58      <---------ANAC58  --------->WOX13(1)      --------->RVE1(2)    ---
            <---------ANAC58      <---------ANAC46 --------->MYB46(3)      <---------GLK1(2)    <---
 --------->DOF5.7(1)              <---------ANAC58 --------->AtMYB61<----------DOF2<---------At4g35610
--------->DOF2                --------->YAB5 --------->ARR11(2)    <---------DOF5.7(1) <---------MYB52(1)
 
tttaaagaggtttttgctttgtttatacataaatgtttcgtctttgtgtattcaccaatccgatttttcttctttacagaatctgtagctgtttggtgag  24833100
                                                                   --------->ARR11(3)
                                                                   --------->RVE1(2)
                                                                   <---------ARR11(3)
       <---------AHL20(2)                                          <---------ARR11(1)
       <---------AHL25(3)                                         <---------CCA1(2)
      <---------YAB1                                      <---------ANAC58
     --------->AHL12(2)      <---------TOE2(2)            <---------ANAC58
     <---------AHL12(2)    --------->TOE2(3)              <---------ANAC46
    --------->YAB1        --------->ANAC58              <---------KAN1<----------DOF2
   <---------KAN1         --------->ANAC58             --------->ARR14(2)
 --------->YAB1           <---------ANAC55(2)          --------->ARR11(2)
------>CCA1(2)  <---------DEAR3(2)                     <---------ARR11(2)                       <---
------RVE1(2)  <---------MYB46(3)                      <---------ARR14(2)      <-----------GT1<-----
 
ataagaataataaatgggtcgtttcaaaaacgtaagtttgtgtttgagtttctctacgaattcgtgttcatatcttttgttttttcagtactatgtgatt  24833200
<- Previous    Next ->

AGI:  At5g61760.1   
Description:  ATIPK2BETA (Arabidopsis thaliana inositol hexakisphosphate 2beta); inositol or phosphatidylinositol kinase. similar to IPK2a (INOSITOL POLYPHOSPHATE KINASE 2 ALPHA), inositol or phosphatidylinositol kinase [Arabidopsis thaliana] (TAIR:AT5G07370.1); similar to IPK2a (INOSITOL POLYPHOSPHATE KINASE 2 ALPHA), inositol or phosphatidylinositol kinase [Arabidopsis thaliana] (TAIR:AT5G07370.4); similar to IPK2a (INOSITOL POLYPHOSPHATE KINASE 2 ALPHA), inositol or phosphatidylinositol kinase [Arabidopsis thaliana] (TAIR:AT5G07370.3); similar to putative inositol polyphosphate kinase [Thellungiella halophila] (GB:ABL11220.1); contains InterPro domain I
Range:  from: 24830955    to: 24832669    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g61770.1   
Description:  PPAN (PETER PAN-LIKE PROTEIN). Identical to Peter Pan-like protein (PPAN) [Arabidopsis Thaliana] (GB:Q9ASU7;GB:Q9FLT1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40017.1); contains InterPro domain Brix (InterPro:IPR007109)
Range:  from: 24832834    to: 24834932    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version