AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                            <------ZmHOX2a(1)
                       --------->LBD16
                      <---------ANAC58
                      --------->HSFB2a(2)
                      <---------ANAC58
                      <---------ANAC46                                              <------ZmHOX2a(2)
                      <---------LBD16                                              <---------GATA12
                   <---------ARR11(2)                                              --------->GATA12
                   --------->ARR14(2)                   <---------At4g35610  <------MYB46(1)
                   --------->GLK1(2)                    --------->At4g35610  <------MYB83
                   <---------ARR14(2)                <---------At4g35610 --------->At4g35610
                  <---------GATA12                 <---------RAP2.6(2)   <---------ZAT2
                  <---------ARR14(2)               <---------ANAC46      <---------At4g35610
                 --------->KAN1--------->KAN1     <---------At5g28300    --------->ZAT2     <XXXXXXX
   <---------ARR11(3) <---------HSFB2a(2)         --------->RAP2.6(3)  <---------ZAT18      <XXXXXXX
   --------->ARR11(3)<---------LBD16             --------->MYB52(1)    --------->ZAT18     ---------
-------DOF2     <---------RVE1(2)        <---------SPL7(1)     <---------ANAC46   --------->At4g35610
 
ttttaagaacttaagcttggagattccgggaggaaaactcgagtcgaacgagttacggctgatgtcgagggtagtgagcttggtgagatcaaagatagaa  24744700
                                                               <---------KAN1
                                                              --------->ARR11(2)
                                                              --------->GATA12
                                                              --------->GLK1(2)
                                                              <---------ARR11(2)
                                                              <---------GATA12
           ------>MYB83                                       --------->ARR14(2)
           ------>MYB46(1)                                    <---------ARR14(2)
        --------->HSFB2a(1)                                   ------->TEIL
        <---------HSFB2a(1)                              <-----------GT1
        <---------HSFC1(2)                               --------->MYB52(1)                   <-----
        <---------KAN1                                --------->ANAC46                       -------
       ------->TEIL                                   <---------ANAC55(2)                   <-------
    <---------MYB52(2)                                --------->ANAC58                     <--------
 --------->ARR11(2)             --------->CCA1(2)     --------->ANAC55(2)                --------->ARR14(2)
 <---------ARR11(2)--------->GLK1(1)          --------->At4g35610                        <---------ARR14(2)
XXXXXXXXXXXXXMIR773<---------GLK1(1)     <---------ZAT6<---------MYB52(2)                --------->GLK1(2)
XXXXXXXXXXXXXMIR773B           --------->GATA12       --------->ANAC58  <------ZmHOX2a(1)<---------ARR11(2)
>CCA1(2)--------->HSFC1(2)     <---------GATA12       --------->ANAC55(1)  <---------KAN1--------->ARR11(2)
 
gttggaaacgaaccttccaaagaattcccactgagatttaagtagagtaagctcgacaagtaacgaatctgtataggaatacgaccagagaggttccggt  24744800
                                                                      <------NtERF2
                                                                     ------>NtERF2
                                                                    <---------ANAC46
                                                                --------->SPL7(1)
                                                               ------>MYB83  <---------WRKY18(1)
                                                               --------->MYB52(1)
                                                             --------->MYB46(3)     <---------DOF5.7(2)
                                                             --------->AtMYB61      --------->MYB52(1)
                                           <---------ZAT14   <---------MYB55(2)    ----------->HVH21
                                <---------ICU4  --------->LBD16------>MYB46(1)<---------At5g28300
                          <---------MYB52(1)    <---------SPL7(1)   <---------DEAR3(1)      --------
                          <---------ARR11(2)  --------->ANAC46--------->MYB55(1)  --------->DOF5.7(2)
                         <---------RAP2.6(3)<---------ALFIN1 <---------MYB52(2)   <---------MYB52(1)
    --------->ALFIN1    ----------->GT1    --------->ZAT14  --------->ANAC58 <-----------GT1<-------
------HVH21           XXXXXXXXXXXXXXXXXXXX>MIR171B/C        --------->ANAC58----------->HVH21<------
-->LBD16         XXXXXXXXXXXXXXXXXXXX>MIR4240 <---------LBD16<---------MYB46(2)  <-------GAMYB
--ANAC46         <---------ANAC58 <---------YAB1----------->HVH21   --------->DEAR3(1)    ------>NtERF2
-LBD16           <---------ANAC58--------->RVE1(2)          --------->ANAC46--------->WRKY38(1)
 
gagagaggtcgagggaaatgacttgagccgttacattatcacagactacaccggaccaagaacaccaaacggcgtcgttttgaccgttaacggggacttt  24744900
                                                                                               -----
                                                                                            --------
                                              --------->DOF5.7(1)                           --------
                                             --------->DOF5.7(1)                          ----------
       --------->DOF5.7(1)                 ---------->DOF2                          <------ZmHOX2a(1)
     ---------->DOF2                   <---------TOE2(3)                          <---------TOE2(3)
->HSFB2a(1)                    <---------ARR11(3)              ----------->GT1--------->At4g35610
--HSFB2a(1)      --------->ALFIN1      <---------TOE1(3)      <---------TOE2(3)   <---------TOE1(3)
----DOF2    <------NtERF2      --------->ARR11(3)  --------->CCA1(2)          <---------At4g35610  -
 
ccagtcttgaaaggcagagggagggccagagagagatgttttaagggaaaggagagacaagagttgaggtgaaaacttgagagctaaggaattgaaagca  24745000
                                                                                    <---------AHL20(2)
                                                                                    --------->AHL20(2)
                                                                                  <---------WOX13(2)
 --------->DOF5.7(1)                                                     --------->HSFB2a(2)
----->DOF2                                                            <----------DOF2---------->DOF2
->ANAC58                                               <---------DOF5.7(1)  ---------->DOF2
->ANAC58                                        --------->KAN1     <---------TOE1(2)<---------AHL25(3)
>DOF2               --------->DOF5.7(1)   <------ZmHOX2a(1)    <---------YAB5     --------->WOX13(2)
--------->DOF2  <------ZmHOX2a(1)        ----------->GT1<----------DOF2  <---------HSFB2a(2)
 
aagaaaggaagtagaagaaggagaaggggatgaagaacaagagaaggagaaatgttcttctttttcatcgtagcttttagaaagaaattaaagtgaagtt  24745100
                <------------CBF
              <---------RVE1(2)
              --------->ARR11(3)
          ----------->GT1                               <---------TOE1(3)
          <---------ANAC46                              <---------TOE2(3)
         --------->ALFIN1           <---------ZAT6  <----------DOF2          -----------------------
        <---------ZAT14       --------->ALFIN1     --------->GATA12       --------->DOF5.7(1)
       --------->ALFIN1    --------->DOF5.7(1)     <---------GATA12   >>>>>>>>>TBF1             >>>>
   <------ZmHOX2a(1)       --------->DAG2------------>CBF          >>>>>>>>>TBF1         <xxxxxxxxxx
 <---------TOE2(3)       ---------->DOF2<<<<<<<<<<<<<<<<<LFY       ------------------------>ANAC81
 
gtttgaggaagtgtggtgatattgttgagaaaggtgttagtgttgacaatggtggatttaagggtttgaagaagaagaagatggaagaagagaagagaag  24745200
                              <---------ANAC58
                              <---------ANAC58
                              <---------ANAC46
                  --------->YAB5                          <---------TOE2(3)
                  --------->ATHB12                        <---------TOE1(3)
                 --------->ICU4                       <-------GAMYB           <---------ANAC46
        <---------YAB1      --------->ALFIN1         <------MYB46(1)       <---------ANAC58
      <---------ICU4      <---------ANAC58           <---------MYB46(3)    <-----------RAV1(1)
      --------->YAB5      <---------ANAC46       <-----------RAV1(1)       <---------ANAC58
     <---------YAB1     <---------ZAT14          <---------MYB46(3)        <---------ANAC46       --
     --------->ICU4<------------CBF           <----------DOF2     <---------YAB1                ----
->ANAC81<---------REM1(1) <---------ANAC58   <---------ANAC58     <---------TOE1(3)          -------
>>>>>TBF1        <---------YAB1              <---------ANAC58  --------->ICU4--------->ALFIN1-------
xxxxxxsmallRNA(s)<---------YAB5      <---------YAB5  <------MYB83 <---------TOE2(3)        ---------
 
aagaagtcatgatgaaggtgatgattgtggagtgcgtctaatggtctggcttttgttggttaaggcattatggtttttgtgtggggaagaaaacaaaagc  24745300
                                                                         --------->ARR14(2)
                                                                         <---------ARR11(2)
                                                                         <---------ARR14(2)
                                                                  ------->TEIL
                                                                <---------ZAT18               ------
<----------ID1                                    <---------DOF5.7(1)    --------->ARR11(2)   <-----
----------->GT1                               <-----------GT1 --------------->AtSPL8        <-------
------->DOF5.7(1)                       <---------DAG2       <---------At5g28300    <---------DOF5.7(1)
------>DOF2                             <----------DOF2     <-----------GT1  --------------->AtSPL8
-->ANAC58                            <-----------GT1 <-----------GT1  <---------ANAC46 <-----------GT1
-->ANAC58    ------------>CBF     <----------DOF2<----------DOF2<---------ZAT14    <----------DOF2
->DOF2 <---------AHL12(2)     <---------DOF5.7(1)<---------DAG2 --------->ZAT14    <---------DAG2<--
 
aaagagaaaaaaaaaactcaatccattttccactcttcttttacttttcttacttttttcaaattactgtacttcgtatactagtacttttttctgtttg  24745400
                                               <---------RVE1(2)
        <---------TOE2(3)                      <---------GATA12
        <---------ANAC55(2)                    <---------GLK1(2)
    --------->WOX13(2)                 --------->YAB1
    <---------WOX13(2)                 --------->ATHB51
 <---------------AGL15                <---------YAB1
 --------------->AGL15        <---------ARR14(2)
 <----------DOF2              <---------ARR11(2)
--------->TOE2(3)             ------->TEIL     <---------ARR11(3)                                  -
--->MYB52(2)                  --------->ARR11(2)                                         --------->YAB1
----MYB46(3)                  --------->ARR14(2)                                 ----------->GT1  --
--MYB52(1)             <---------AHL25(3)      --------->GATA12                  <---------ANAC46 --
---------GT1   ------->TEIL----------->GT1     --------->ARR11(3)   --------->YAB1     --------->RVE1(2)
 
ttacctttattaagtatgaaccaaaataaaacgtatatactataattgtagattttgtttttgttttgccatcatacaagtattgggtaaaatcagaaac  24745500
                                                --------->ARR11(3)
                                                <-----------ARR10
                                                <---------ARR11(3)
                                      <---------GLK1(2)
                                      <---------GATA12                                           <--
                                      <---------RVE1(2)                             <---------YAB1
                                      --------->GATA12                              <---------AHL12(2)
                                      --------->ARR14(2)                           --------->AHL20(2)
                                    ----------->ARR10                              <---------AHL20(2)
                                 <---------WOX13(2)                <---------WOX13(2)      <--------
                                 --------->WOX13(2)              <---------AHL20(2)--------->AHL20(3)
                               <---------AHL12(1)              ------>ZmHOX2a(1)   <---------AHL25(2)
   --------->ANAC58            --------->AHL25(1)              <----------DOF2     <---------AHL25(1)
   --------->ANAC46            --------->AHL25(3)           ---------->ID1      --------->WOX13(2)
   --------->ANAC58            --------->AHL20(2)       <----------DOF2         <---------WOX13(2) -
-------->RVE1(2)            --------->YAB5     <---------CCA1(2) --------->AHL20(2)--------->AHL25(1)
---->MYB83     --------->YAB1  <---------AHL20(2)  <----------DOF2 --------->WOX13(2)     <---------
---->MYB46(1) <---------ATHB12 --------->AHL12(1) <---------DOF5.7(1)         ------>ZmHOX2a(1) <---
 
caaatcacacaatgccactcatattaaaaaccgattaattagatttgctagtatcttttctttgtcctttaatttcttctcctcattaaaattctttttt  24745600
<- Previous    Next ->

AGI:  At5g61480.1   
Description:  leucine-rich repeat transmembrane protein kinase, putative. similar to leucine-rich repeat transmembrane protein kinase, putative [Arabidopsis thaliana] (TAIR:AT4G28650.1); similar to BAM1 (big apical meristem 1), ATP binding / kinase/ protein serine/threonine kinase [Arabidopsis thaliana] (TAIR:AT5G65700.1); similar to BAM3 (big apical meristem 3), ATP binding / protein serine/threonine kinase [Arabidopsis thaliana] (TAIR:AT4G20270.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO60856.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN65669.1); similar to hypothetical protein OsJ_024991 [Oryza sativa (japonica cultiva
Range:  from: 24741767    to: 24745068    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version