AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                                  <-
                                                                                              <-----
                                                                                              ------
                                                                                           ---------
                                                                                           <--------
                                                                                          --------->TOE1(3)
                                                                                          --------->TOE2(3)
    --------->TOE2(3)                                                                   <---------TOE2(3)
    --------->RVE1(2)              --------->ZAT6                                       <---------TOE1(3)
  --------->RVE1(2)              <-----------HVH21                                      <---------YAB5
--------GT1               <---------ICU4                 ------->TEIL                   <---------YAB1
---ZAT6                  <---------YAB5 <---------WOX13(2)                           <---------YAB5
>YAB1               --------->At4g35610 --------->WOX13(2)             ----------->GT1 <---------DOF5.7(2)
 
tacccaatctcaaactgaaaatgagctaaacatggctgtcactaatttagaacaaaaatgaacatttctaaacactgaaaaaactatagttatcgttaat  24684800
                           --------->ANAC46
                          --------->MYB46(3)                                               <--------
  <---------KAN1       ------->GAMYB                                                       ---------
<------ZmHOX2a(1)    --------->WOX13(2)           <----------DOF2                          ------>MYB83
--------ANAC46      <-----------GT1              <---------DOF5.7(1)                       ---------
----WOX13(2)     <----------DOF2         <---------MYB59                   --------->ZAT14 ---------
--->WOX13(2)    --------->YAB5     --------------->AtSPL8               --------->ANAC58   ------>MYB46(1)
>DOF5.7(2)    <---------ARR11(3)   <---------------AtSPL8        ----------->GT1 ---------->DOF2----
-MYB52(1)     --------->ARR11(3)   <---------------AtSPL3<-----------GT1--------->ANAC58   <--------
 
ggaggataagagtttgaaatctttaactgcccaccaatttagtacctcactgtctttatttttctaatttgtaacaagtaaactcaaagaaacctatcca  24684900
        <---------TOE1(3)
    <---------WOX13(2)
    <---------AHL12(2)
    --------->WOX13(2)
   <---------AHL25(3)                                                 <---------DAG2
  <---------AHL25(3)                                                  <----------DOF2
  --------->AHL25(3)                                             <-----------GT1
  --------->AHL20(2)                                       <---------AHL25(2)
  <---------AHL12(1)                                       <---------AHL25(3)
  <---------AHL25(1)                                       --------->AHL25(2)
  --------->AHL25(1)                                      <---------AHL25(3)
  --------->AHL25(2)                                      --------->AHL12(1)
  <---------AHL20(2)                                      <---------AHL25(1)
  <---------AHL25(2)                                      <---------AHL12(2)
  --------->AHL12(1)                                      --------->AHL12(3)
  --------->AHL12(3)                                      <---------AHL12(3)
  <---------AHL12(3)                                      <---------AHL12(1)
  --------->AHL20(1)                                     <---------AHL12(2)
 --------->AHL20(2)                                      --------->AHL12(2)
 <---------AHL25(2)                                      --------->AHL20(1)
 --------->AHL25(1)                                      <---------AHL25(2)
 --------->AHL25(2)                                      --------->AHL12(1)
 <---------AHL25(1)                                      <---------AHL12(1)
 --------->AHL25(3)                                      <---------ARR11(3)
 <---------AHL12(3)                  --------->At4g35610 --------->ARR11(3)
 --------->AHL12(3)                  <---------At4g35610 --------->AHL25(2)
--------->AHL12(2)      <---------AHL12(1)               <---------AHL20(1)
<---------WOX13(2)      --------->AHL12(1)               --------->AHL25(3)            <----------DOF2
--------->WOX13(2)     --------->AHL25(2)               <---------AHL25(2)             <---------DOF5.7(1)
-ARR11(2)              --------->AHL20(2)               <---------AHL12(3)            <---------DOF5.7(1)
>ARR11(2)              <---------AHL12(2)               <---------AHL12(2)    <-------MYC3
>RVE1(2)<---------TOE2(3)  ------------>CBF             --------->AHL12(3)    ------->MYC2  <-------
>ARR14(2)              --------->AHL12(3)               --------->AHL25(2)    ------->MYC3  <-------
----->ANAC46           <---------AHL25(1)               --------->AHL12(2)    <-------MYC2<---------DOF5.7(2)
-ARR14(2)  <----------DOF2--------->RVE1(2)---------->DOF2--------->AHL25(1) --------->ANAC46
 
caaaattaattaagcttttgactaaaaaaaatcaattctcatcttccaaagaaaacaaaaaatatttcttacacttttgcacgttgctccctttaacgtg  24685000
                                    --------->RVE1(2)
                                ---------->DOF2
                              --------->AHL20(2)
                              <---------AHL20(2)
                              <---------AHL25(3)
                            --------->WOX13(2)
                            <---------WOX13(2)
                            <---------AHL12(2)
                           <---------AHL12(2)
                          <---------AHL20(2)
                          --------->AHL25(2)
                          <---------AHL12(1)
                          <---------AHL20(3)
                          <---------AHL25(2)
                          <---------AHL25(1)
                          --------->AHL25(1)
                          --------->AHL20(3)
                          --------->AHL12(1)
                          --------->AHL25(3)
                          <---------AHL25(3)                              <------NtERF2
                          --------->AHL20(1)                      <-----------GT1
                          <---------AHL20(1)                      <---------ARR11(2)
                          --------->AHL20(2)                     <---------KAN1
                         --------->AHL25(3)        <---------ARR11(3)    --------->ANAC58
                        <---------AHL12(2)         --------->ARR11(3)    --------->ANAC58
                        --------->AHL12(2)--------->AHL20(2)     --------->KAN1
       ------------>CBF--------->YAB1<------ZmHOX2a(2)       ----------->GT1
 ----------->RAV1(1)--------->TOE2(3)------------>CBF----------->GT1 ------->GAMYB
--ANAC58           --------->YAB5   --------->ARR11(3)--------->TOE1(3)  --------->RAP2.6(2)
--ANAC58          <---------ATHB12  <---------ARR11(3)--------->TOE2(3) --------->SPL7(1)
 
cttccaacaaaacaattctcaaacattaataaattaaaagatcaataaaacaaatatcgttaaatcgtataaccggccgcaagtttttaagtagtttttg  24685100
                                                                     --------->DEAR3(1)
                                                                     --------->AtMYB61
                                                                     <---------ALFIN1
                                                                  --------->AtMYB61         <-------
                                                                  <---------ALFIN1        <---------RVE1(1)
                                                                  --------->DEAR3(1)      --------->KAN1
                                                                 --------->MYB46(3)       <---------KAN1
                                                               --------->AtMYB61         <---------RVE1(2)
                                                               --------->DEAR3(1)        --------->ARR14(2)
                                                               <---------ALFIN1          <---------ARR14(2)
             --------->YAB5                                   --------->MYB46(3)         --------->ARR11(2)
          <-----------GT1                                   <---------ALFIN1             <---------ARR11(2)
      ----------->TBP        <---------YAB1                 --------->ANAC46             <---------ARR11(3)
    <----------DOF2        --------->KAN1--------->KAN1   ------>ZmHOX2a(1)          <---------LBD16
    --------->TOE1(3)    <---------RVE1(2)         ------>ZmHOX2a(1)--------->MYB46(3) --------->LBD16
    --------->TOE2(3)  <---------YAB1--------->TOE2(3) ------>ZmHOX2a(1)--------------------->WRI1
 
ttcaaaactttaaaaaccattcgtttttgattatgctaaacctctaattctctccttcctcctccaccaccaccaccttcaaaacctcgccggatattat  24685200
                 <-----------GT1
             ----------------------->TaNAC69(2)
           <---------YAB5                                                                     ------
     --------->KAN1                                                 --------->ARR14(2)      <-------
    --------->ARR11(3)               ------>ZmHOX2a(1)              <---------ARR11(3)      <-------
    <---------GATA12       <-------MYC3                       --------->RVE1(2)             <-------
    <---------RVE1(2)      ------->MYC3                       <---------GATA12              <-------
    --------->GATA12      <---------O2                        --------->GATA12      --------->ZAT2
    <---------ARR11(3)    --------->O2                        <---------ARR14(2)    <---------ZAT2
    <---------ARR14(2)    <---------TGA1a                <-----------HVH21          <---------At4g35610
    <---------GLK1(2)    <---------TOE2(2)   --------------------->WRI1             --------->At4g35610
    --------->ARR14(2)   <---------TOE1(2)  <---------DOF5.7(1)     <---------ARR14(2)    <---------ICU4
  ----------->ARR10     <---------ALFIN1------>ZmHOX2a(1)--------->TOE2(3)     --------->ANAC46 ----
 <------ZmHOX2a(1)   ------>ZmHOX2a(1) <---------ALFIN1<---------YAB5   <---------YAB5    --------->YAB5
--YAB1    <-----------TGA1--------->TGA1a  ------>ZmHOX2a(1)  --------->ARR14(2)  <-----------RAV1(2)
 
gggaggagattttcgtcatttctcctcccacgtttctctcctcctcctcttccttctcatcgtcaaatccagttcttcattcactccagctgataactac  24685300
                                                                           <---------ARR11(2)
                                                                --------->GLK1(2)
                                                              --------->MYB46(3)
                   --------->ANAC58                       <------ZmHOX2a(2)--------->ARR11(2)
                   --------->ANAC58                 <---------ARR14(2)     <---------ARR14(2)
                 ------>NtERF2                      <---------GATA12       --------->ARR14(2)
     <---------KAN1--------->ANAC46                 --------->ARR11(2)  <---------ANAC46
-->P <-----------RAV1(1)                            <---------ARR11(2)  <---------ANAC58
--MYB111(1)     --------->DEAR3(1)                  --------->RVE1(2)<---------MYB52(1)
-----MYB.PH3(2) ----------->HVH21        ----------->GT1 --------->GATA12 <---------CCA1(2)
--MYB111(2) --------->ATERF1(1)    ------>NtERF2    --------->GATA12<-----------HVH21
--MYB46(2) <---------ATERF1(1)    ----------->HVH21--------->KAN1  --------->ANAC46   --------->At4g35610
----->TOE2(3) ------>ZmHOX2a(1)   --------->DEAR3(1)--------->ARR14(2)  <---------ANAC58
 
ctcatcgattgtggctcctccgacgaaacaaaactctccgacggtcgtaatttcaaatccgatcaacaatccgtcgcgtttcttcaaacagatgaagaca  24685400
                                                                                    --------->RVE1(2)
                                                                       <---------HSFB2a(1)
                                                                       <---------KAN1
                                                                       <---------HSFC1(2)
                                                                       --------->HSFC1(2)
                                                                       --------->HSFB2a(1)
                                                                      --------->GLK1(2)
                                                                      <-----------ARR10
                                       --------------->AtSPL8         --------->ARR11(3)
                             ------>MYB83                             --------->ARR14(2)
                           --------->DREB2C(2)           --------->ANAC55(2)   --------->LBD16
         <---------ETT(2)  --------->DEAR3(1)            --------->ANAC46    <---------LBD16
         --------->WRKY38(1) ------>MYB46(1)           <---------YAB1 <---------ARR14(2)
       <-----------HVH21   --------->MYB46(3) <---------DOF5.7(1)    <---------GLK1(2)
       --------->LBD16 <------ZmHOX2a(2)   <---------ZAT18  --------->MYB52(1)--------->LBD16
   --------->TOE2(2)  <-----------HVH21--------------->AtSPL3 --------->MYB46(3)<------NtERF2    ---
 
tcaaaacctccgtcgactcaattccgatcaccgactctaatgccagtacccttcccttatacttaaccgctagaatcttcgccggaaaatcaacttactc  24685500
                                                                                                  <-
                                                                                                  --
                                          <-----------GT1                                         --
                                        <---------AHL20(3)                                        --
                                        --------->AHL20(3)                                        --
                             =========================HOX2a_HOX2a                                 --
                             =====================================HOX2a_HOX2a                     --
                             ------>ZmHOX2a(2)                                                    --
                            ==========================HOX2a_HOX2a                              -----
                            <------ZmHOX2a(2)         --------->YAB1                           <----
                           --------->ARR11(2)         --------->KAN1                           -----
                           --------->ARR14(2)        <---------ATHB12                     <---------
         --------->ANAC46  <---------GATA12          <---------YAB5                       <---------
         --------->ANAC58  <---------ARR14(2)      --------->WOX13(1)    --------->MYB46(3)   ------
         --------->ANAC58  <---------ARR11(2)  ------>ZmHOX2a(1)         <------------MYB.PH3(2) ---
       <-----------GT1     --------->GATA12<-----------GT1         --------->RVE1(2)     --------->ANAC46
--->ZmHOX2a(1)     <-----------HVH21   <---------DOF5.7(1) ------>ZmHOX2a(1)       <---------DOF5.7(1)
 
cttctacatttcacgacctggtcgtcactggatccgtctccatttttatcctctcaatcatcctctctacaatctaacaaactccgtcttctccgtcacc  24685600
    --------->DEAR3(1)
    --------->AtMYB61
    <---------ALFIN1
   --------->MYB46(3)
   <---------ABI4(2)
  ------>NtERF2                                                               <------NtERF2
 <---------ALFIN1                   --------->ARR11(3)                       <---------At4g35610
 --------->ANAC46                   <---------RVE1(2)                        --------->LBD16
--------ETT(1)                      <---------ARR14(2)                       <------NtERF2
------->DEAR4(1)                    --------->ARR14(2)                       ------>NtERF2
------->At1g77200                   <---------ARR11(3)                      ----------->RAV1(1)
----->GAMYB                         <---------ARR11(2)                      --------->RAP2.3(2)
--------->HVH21                    --------->GLK1(1)                       <---------LBD16
------->ANAC46                    ----------->ARR10                        --------->RAP2.3(1)
------->DEAR3(1)                 <------NtERF2                            ------>NtERF2
------->DREB2C(2)              --------->DEAR3(1)                   <-----------ARR10
---->DEAR3(1)                 <---------LBD16                  --------->RVE1(2)
-----ALFIN1                  --------->LBD16                   <-----------ARR10
---->AtMYB61 <---------DOF5.7(1)--------->LBD16                <---------ARR11(3)            <------
--TGA1  --------->ORA47(1)  --------->ANAC46                   --------->ARR11(3)   --------->KAN1
--HVH21--------->DEAR3(1)   --------->DEAR3(1)                <---------KAN1--------->DEAR3(1)
--->MYB46(3)------>ZmHOX2a(1)------>NtERF2                  <---------GLK1(2)--------->At4g35610
------>DEAR3(2)            <---------LBD16              ---------->DOF2  --------->ANAC46   <-------
 
accgacaccaccgtcctcttacacgatttctccgccggagatacttcttctatcgtcttcaaagaatatctaatctacgccgcagagaaactctctcttt  24685700
<- Previous    Next ->

AGI:  At5g61350.1   
Description:  protein kinase family protein. similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT4G39110.1); similar to THE1 (THESEUS1), kinase/ protein kinase [Arabidopsis thaliana] (TAIR:AT5G54380.1); similar to protein kinase family protein [Arabidopsis thaliana] (TAIR:AT2G21480.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO47576.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO64509.1); similar to protein kinase family protein, putative, expressed [Oryza sativa (japonica cultivar-group)] (GB:ABF98993.1); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Prote
Range:  from: 24685199    to: 24687727    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version