AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
            ----------->GT1     --------->DOF5.7(1)   ---------->DOF2      <----------DOF2         <
          --------->At4g35610 <---------KAN1         <---------KAN1        <---------DAG2      <----
 --------->RVE1(2)      --------->DOF5.7(1)    --------->DOF5.7(1)<---------TOE1(3)          <------
-------At4g35610      ---------->DOF2        ---------->DOF2      <---------TOE2(3)         <-------
 
agcaaatcaaatgggctgaaataacaaaagagaataaggcccagttacaaaagagaataaagttttgttaagggttaacttttttttttgttttcctttt  24577300
                       --------->AHL20(1)
                       <---------AHL25(1)
                       <---------AHL25(3)
                       <---------YAB1
                       --------->AHL25(1)
                       --------->AHL25(2)
                       --------->AHL20(2)
                       <---------AHL20(2)
                       <---------AHL20(3)
                       <---------AHL25(2)
                      <---------AHL12(3)
                      <---------AHL20(2)
                      --------->AHL20(2)
                      <---------AHL20(3)
                      --------->AHL20(3)
                      --------->AHL25(3)
                      --------->AHL12(3)
                      <---------AHL25(1)
                      <---------AHL25(2)
                     --------->AHL12(2)
                     <---------AHL12(2)
                    <---------AHL20(3)
                    <---------AHL25(2)
                    --------->AHL20(3)
                  --------->AHL25(3)                                               --------->ANAC55(2)
                  <---------YAB1                                                   --------->ANAC46
                 <---------AHL20(1)                                          <---------AHL20(3)
                 --------->AHL20(2)                                          <---------AHL25(2)
                 --------->AHL20(3)                                          --------->AHL25(2)
                 <---------AHL20(2)                                          <---------AHL12(3)
                 --------->AHL25(2)                                          --------->AHL20(3)
                 <---------AHL20(3)                                          <---------AHL12(2) ----
 --------->AHL20(2) --------->AHL25(2)                                --------->YAB1            ----
----------DOF2   <---------AHL25(2)                                 <---------WOX13(2)        <-----
-----CCA1(2)    --------->YAB1                                      --------->WOX13(2)        <-----
---DOF5.7(1)   <---------YAB1 ----------->RAV1(1)             <------ZmHOX2a(1)<---------AHL25(3)
---DOF2        <---------AHL20(2)--------->YAB1       <---------TOE2(3)     --------->YAB1 <--------
 
atcttttaatacttctatattataattttattgcaacaatattcaaactagaagtttaatgtataggattcaattacaaaaattatacgtagttttacca  24577400
                           --------->ARR11(3)
                           <---------ARR11(3)
                           --------->RVE1(2)
                           <---------AHL20(1)
                 --------->WOX13(2)
                 <---------WOX13(2)
               --------->AHL20(2)
               <---------AHL20(2)        ----------->GT1          <---------AHL20(2)
               --------->AHL25(3)    <---------WOX13(2)          --------->AHL25(3)               <-
-->MYB46(1)    --------->AHL25(1)    --------->WOX13(2)        <---------DOF5.7(1)               <--
-->MYB83   ----------->GT1 --------->AHL20(1)                 <----------DOF2                    ---
----MYB46(2)   <---------AHL25(1) --------------->AGL15      <---------DOF5.7(1)                 ---
----MYB59 --------->DAG2  --------->RVE1(1)            <---------KAN1   <---------ANAC46         ---
---GT1   ---------->DOF2  --------->CCA1(1)    <---------YAB5--------------------->WRI1       ------
 
aacttctaagaaaaaagtttaatttcgaaatatctttctaagttaagttaatcttcgaattcttcctttttattttcgtttaaaaaccaaaatagagaga  24577500
                                                                   <---------ANAC55(2)
                                                                   <---------ANAC58
                                                                   --------->ANAC55(2)
                                                                   <---------ANAC58
                                                                  ------->TEIL
                                                                  <-------TEIL
                                                       --------->YAB1
    <---------YAB1                                     --------->YAB5
--------AHL20(2)                                  --------->MYB46(3)
-------AHL25(1)                                 -------->P        --------->SPL7(1)
------>AHL25(3)                              <---------ANAC58   <---------SPL7(1)             <-----
------>AHL25(1)                           <---------KAN1       --------->TOE2(1)          <---------ARR11(3)
------>AHL20(2)                 <---------ANAC55(2)   <---------ATHB12        <---------YAB1<-------
----->GT1                   <-----------HVH21<---------ANAC58  --------->TOE1(1)<---------RVE1(2)
 
ttaaatcgttataggcttagagctactgggctgtcacataaacgaatgacttacccaatgaaaaccccgtacgtgtctaatatgattttccaaaatcatt  24577600
                        <---------ARR11(3)
                        --------->GATA12
                        --------->ARR11(3)
                        --------->ARR11(2)
                        <---------ARR11(2)
                        <---------GATA12
                        <---------ARR14(2)
                        --------->AGP1
                        --------->ARR14(3)
                        <---------AGP1
                        <---------ARR14(3)
                        --------->ARR14(2)
               <---------WOX13(1)
             --------->ATHB12
            --------->ICU4                                                           --------->ANAC58
            <---------YAB1------>ZmHOX2a(2)                                       <---------SPL7(1)
    --------->MYB52(1)  <---------RVE1(2)             <---------HSFB2a(2)      --------->MYB52(1)
  <-------TEIL<------------CBF                        --------->HSFB2a(2)      <-----------GT1
<---------GATA12       <---------CCA1(2)             <---------LBD16        *TSS  ------->GAMYB
--------->GATA12<---------KAN1                    <----------DOF2        <---------TOE2(3)
----YAB1<-----------HVH21<------ZmHOX2a(2)       <---------DOF5.7(1) <----------DOF2 --------->ANAC58
--ICU4 ------->GAMYB  ----------->ARR10  ----------->TBP          ----------->GT1--------->MYB46(3)
 
ttagattcaacggtcacgattgactcagatcttgcaacttcgctacataaaccctttctgggagaagtagggttttaagttttaacggacgcgagaaatc  24577700
                           <---------ZAT14
                           --------->ZAT14                                            <----------DOF2
                           <---------ZAT18                            <---------At4g35610
                        <-------TEIL                               <---------MYB52(1)<---------DOF5.7(1)
                    --------------->AtSPL8                   ------->TEIL           <-------TEIL
                    --------------->AtSPL3                   <---------GATA12    <---------HSFC1(2)
                    <---------------AtSPL3              <----------DOF2          --------->HSFB2a(1)
                    <---------------AtSPL8            <---------At4g35610        --------->HSFC1(2)
                --------->ZAT14               <-----------GT1--------->GATA12   <---------TOE1(3)
                --------->REM1(2)    --------->ANAC58 <---------ZAT2  --------->At4g35610      <----
                <---------ZAT14      --------->ANAC58 --------->At4g35610       <---------TOE2(3)<--
  <------ZmHOX2a(1) <---------ZAT6<---------REM1(2)   --------->ZAT2 --------->MYB52(2)   <---------
 
acagaggaagcgaagtcagtgtagaggtacttcactcttcacgctcatttcactctcagctttgaatctcgttagctgttttgaaggttctttcttttct  24577800
                                                                 <---------ANAC55(2)
                                                                 --------->ANAC55(2)
                                                                 <---------TOE2(3)
                                                        <----------DOF2
                                                       ------>ZmHOX2a(2)
                                                       <---------DOF5.7(1)
                                                      <------ZmHOX2a(2)
                                                     --------->GATA12
                                                     <---------GATA12
                                                     --------->ARR11(3)
                                                     <---------ARR14(2)
                                                     --------->ARR14(2)
                                                --------->ARR14(2)
      --------->ZAT14                           --------->ARR11(2)
   <---------ANAC58                             <---------ARR11(2)                         ------>ZmHOX2a(1)
   <---------ANAC46                             <---------ARR14(2)                        --------->TOE2(3)
   <---------ANAC58                          <---------TOE2(3)  <---------At5g28300    <---------ARR11(2)
 <---------YAB1           <---------DAG2     --------->MYB59   <-----------GT1  <----------DOF2
-----YAB1                 <----------DOF2<---------GATA12     <---------SPL7(1) <---------DOF5.7(1)
-------RVE1(2)<---------MYB52(1)         <---------RVE1(2)  <---------ZAT6      <---------DAG2
-DOF2 <---------ZAT14 ---------->ID1<---------AtLEC2 <---------ARR11(3)      <-----------GT1
 
gattttgagtgttctctgttatttcttcgcttttcattttcatggatttaggttccgatctttgtgttacggtattgaattcactttttggttccttagt  24577900
                                                  --------->GATA12
                                       ---------->ID1
                                    <---------WOX13(1)
                                   <---------RVE1(2)     <---------DOF5.7(1)      ------->TEIL
                                   >>>>>>>>>ARR2<---------TOE1(3)         --------->DAG2       <----
                                 <---------YAB1 <---------TOE2(3)        ---------->DOF2       <----
                               <----------DOF2  <---------YAB1           --------->DOF5.7(1) <------
                          ---------->DOF2     <-----------GT1    --------->DOF5.7(1)         -------
     ------->TEIL  ----------->GT1--------->ATHB12<---------GLK1(2) ----------->GT1        <--------
 
agttcatgtatttgcagagtacgagttaaaaaagctttgattgtcgtttttaagattcccttcttcttaagggggaaaaagtatgaaacttgctaatttc  24578000
                       <--------HAHB4
                       --------->YAB5                                                           <---
                       --------->ATHB12                                                        <----
                       --------->YAB1             <------NtERF2                      <---------WOX13(2)
                       <---------ICU4             <---------At4g35610           --------->ARR11(3)
                      <---------YAB5              --------->At4g35610           --------->RVE1(2)<--
                      <---------YAB1             <---------MYB46(3)            <---------GLK1(1)----
                      --------->ICU4      <---------ARR14(2)                   --------->GLK1(1)====
-----ANAC58         --------->YAB1        --------->ARR14(2)                  <---------ARR11(3)<---
-----ANAC58      <---------bZIP60(1)      <---------ARR11(2)            <---------YAB1         <----
---AHL20(2)      --------->bZIP60(1)  <-----------GT1            <----------DOF2<---------ARR11(3)
-->ARR11(3)    --------->YAB1      --------->WOX13(2)          ---------->ID1 --------->ARR11(3)<---
-WOX13(2) <------ZmHOX2a(1)  <----------DOF2 <-----------RAV1(1)<---------DOF5.7(1)  --------->WOX13(2)
 
ttgatagaaaataggaaatgatatcatcattactttgaaattgactatctggtggctgaagtatttgtctttttcatgctagatatctaattgcgatggc  24578100
                                                                                             -------
       --------->KAN1                                                                        -------
   ----------->GT1                                                                    --------->ANAC46
------------AGL15                                                               <---------DOF5.7(1)
-----ANAC58 --------->HSFB2a(2)                                                <----------DOF2  ----
-------DOF5.7(1)                        --------->ANAC58             --------->ANAC58 --------->ANAC58
----------->AGL15         <---------At4g35610          <---------TOE1(3)       <---------DAG2<------
===============================================================================================MADS_MADS
------DOF5.7(1)   --------->ARR11(3)    --------->ANAC46             --------->ANAC58 --------->ANAC58
-----ANAC58 <---------HSFB2a(2)         --------->ANAC58      <----------DOF2  --------------->AGL15
-------DOF2<---------LBD16--------->At4g35610         <-----------RAV1(2)      <---------DOF5.7(1) -
 
ttttttgagtaaattcgggaacatattgaagcagaccacaaacaagcaactcaatgctcaggtttctttatcaagcccttcgctttttcaagcaataagg  24578200
<- Previous    Next ->

AGI:  At5g61030.1   
Description:  GR-RBP3 (glycine-rich RNA-binding protein 3); RNA binding. similar to GR-RBP5 (glycine-rich RNA-binding protein 5), RNA binding [Arabidopsis thaliana] (TAIR:AT1G74230.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO64431.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN71872.1); contains InterPro domain RNA recognition motif, glycine rich protein (InterPro:IPR015465); contains InterPro domain RNA recognition motif, RNP-1; (InterPro:IPR000504); contains InterPro domain Nucleotide-binding, alpha-beta plait; (InterPro:IPR012677)
Range:  from: 24577677    to: 24579532    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version