AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
<---------TOE2(3)                <---------------AGL15
--------MYB52(1)                 <----------DOF2
--------DOF2                    --------------->AGL15                 <---------ANAC58    <---------ARR11(2)
------DOF5.7(1)            ---------->ID1                      <-----------HVH21    ------->GAMYB
---WRKY18(1)           <---------ANAC58                   --------->MYB46(3)       --------->ZAT6
--->HVH21              <---------ANAC58      --------->ZAT6   --------->AtMYB61  <-----------GT1
--DOF2            <<<<<<<<<TBF1 --------->TOE2(3)  <----------DOF2    <---------ANAC58    --------->ARR11(2)
-WOX13(1)      <<<<<<<<<TBF1    <-----------------AGL3   --------->ANAC46       <-----------GT1
 
ctttaggtttcggttttcttcttcttccttgtcttcctttactaggtaagactactttccactcaccatcactgcttgagtttttaacagtcgtttccat  24018800
                                                                                       --------->ARR11(2)
                                                                                       <---------ARR11(2)
                                                                                     <---------MYB46(3)
                                      <---------ALFIN1                      --------->KAN1
            --------->GLK1(2)        <---------ZAT14                        <--------ATHB1         -
         --------->ANAC46          --------->ANAC46                         --------->ATHB12       -
         --------->ANAC58        --------->KAN1                             --------->YAB5         -
         --------->ANAC58   ------>ZmHOX2a(2)                               <---------ICU4       <--
     <---------HSFB2a(2)  <---------ARR11(3)                                --------->YAB1       <--
     --------->HSFB2a(2)  --------->GATA12              <---------TOE2(3)  <---------ATHB12      <--
<---------HSFC1(2)        --------->RVE1(2)             <---------TOE1(3)  <---------YAB1       <---
--------->HSFC1(2)        <---------GATA12          --------->WOX13(2)     --------->ICU4       ----
<---------At4g35610       --------->AGP1            <---------WOX13(2)     <---------YAB5 <---------YAB1
--------->HSFB2a(1)     ------>ZmHOX2a(1)      --------->LBD16   --------->ANAC46  <---------MYB52(1)
 
tgaagcttccacaagaaactggttttcctgatctacttactccacagtcccccaaaattagggtttctactcaatgcaatgattccattggttccgatta  24018900
           --------->AHL12(3)
           --------->AHL12(2)
           <---------AHL12(3)
          <---------AHL25(1)
          --------->AHL25(2)
          <---------AHL20(2)
          --------->AHL20(1)
          --------->AHL12(1)
          <---------AHL25(2)
          --------->AHL25(1)
          <---------AHL25(3)         --------->WOX13(1)
          <---------AHL20(1)       <---------YAB1
          --------->AHL20(2)      <-----------GT1
          --------->AHL25(3)     <---------ICU4
          <---------AHL12(1)     --------->YAB1
         --------->AHL25(3)     <---------YAB5
 --------->YAB1                 --------->ICU4
----->MYB83<---------AHL12(2)  --------->WOX13(2)
----->MYB46(1)                 <---------WOX13(2)                                  --------->ARR11(3)
-------->MYB52(1)             ------>MYB46(1)                             <---------WOX13(1)
-------MYB46(2)             --------->TOE2(3)            --------->GATA12--------->GATA12
-------MYB59  <-----------GT1 ------>MYB83          --------->ZAT6     <---------RVE1(2)
-------MYB111(1)            <---------MYB59    <---------ANAC58        <---------TOE2(3)
------ANAC55(2)        ------>ZmHOX2a(1)       <---------ANAC58    <----------DOF2 <---------ARR11(3)
----->ANAC55(2)       --------->TOE2(3)    <----------DOF2 ------>ZmHOX2a(2)       --------->GLK1(2)
 
cctaacatcacaataaatttcgattcctaaacctaattatcaatctctttgcttaactctgatctatctactttgagattgacaaaaatcttcgataccg  24019000
                                                      <---------ANAC46
                                                      <---------ANAC58
             --------->YAB5                       <---------ANAC58
            <---------YAB1                       <---------HSFC1(2)
          --------->MYB52(1)             ==================================HOX2a_HOX2a
         --------->TOE1(2)               <------ZmHOX2a(2)
         --------->TOE2(2)              --------->ARR11(3)
    --------->AHL25(1)                  --------->RVE1(2)
    <---------AHL20(2)                  <---------ARR11(3)
    --------->AHL20(2)              <------ZmHOX2a(1) <---------ANAC58                         -----
    <---------AHL25(3)           <------ZmHOX2a(1)<---------ANAC58         <---------MYB52(2)  -----
    <---------AHL25(1)           ===============HOX2a_HOX2a              ---------->DOF2    --------
   <---------AHL12(2)         <-----------RAV1(2)--------->HSFC1(2)   --------->ANAC58  <---------KAN1
  --------->WOX13(2)  --------->ANAC58  --------->GATA12              --------->ANAC58 --------->ARR14(2)
  <---------WOX13(2)  --------->ANAC58  <---------GATA12            <------ZmHOX2a(1)  <---------ARR14(2)
 
agcaaaattaaacttacgattagagacgaaaacacaggaggaagatcgaagaagcttgcttgaaatacagaggaagcaaagaacgcttcgaatatgtggt  24019100
                                                                                      <------MYB46(1)
                                                                                      ----------->GT1
                                        <-----------HVH21                             <------MYB83
                                      ------>NtERF2                               <---------RVE1(2)
                                     --------->DEAR3(1)                           <---------ARR14(2)
                                    <----------CDC5                               --------->ARR11(3)
                                    <------NtERF2                                 --------->GATA12
                                  <---------DEAR3(1)                              --------->ARR14(2)
                                 --------->SPL7(1)                                --------->ARR11(1)
                              <------MYB83 <---------LBD16                        <---------GATA12
                              <------MYB46(1)<---------LBD16                      <---------ARR11(3)
                              <---------ANAC58                                  ----------->ARR10
                              <---------ANAC58          *TSS                <---------HSFB2a(2)
    <---------ZAT14          <---------AtMYB61<---------DEAR3(1)   --------->ATHB12  --------->MYB59
    --------->ZAT14          --------->MYB46(2)        ----------->GT1     --------->ANAC58
    <---------ZAT18          --------->MYB59<---------ANAC46    <---------At4g35610--------->ARR14(1)
    --------->ZAT18          <---------MYB46(3)       --------->DAG2       --------->ANAC46
---->WRKY38(1)               --------->MYB111(2)     ---------->DOF2       --------->ANAC58
------>HVH21                 --------->MYB111(1)------>NtERF2   --------->At4g35610--------->CCA1(2)
->ALFIN1         --------->KAN1  --------->ZAT18<------NtERF2 <-----------RAV1(2)<---------KAN1  <--
 
gaccgagtggactcagtgagacatttgtgagtttggtgcgccgagtcgcgcggcgataaagtgaatcagatgatttgtacgcgaagatttggtaaacagg  24019200
                                        --------->DOF5.7(1)
                                        ---------->DOF2
                                       ---------->DOF2
                                      <---------ATHB12
                                  ------------>CBF
                                  ----------------->AGL3
                              --------->ANAC58
                              --------->ANAC58
                           <---------ARR14(2)
                           --------->ARR14(2)
                           --------->ARR11(1)
                           <---------RVE1(2)                                ------>ZmHOX2a(1)
                           --------->ARR11(2)                             <---------ANAC58
                         ----------->ARR10                                <---------ANAC46
          <---------ARR14(2) <-------TEIL--------->DOF5.7(1)            <-----------GT1
          --------->ARR14(2)--------->CCA1(2)                 --------->ZAT14           <---------YAB1
          <---------ARR11(2)--------->ARR14(1)               ------->GAMYB<---------ANAC58<---------RVE1(2)
         <------ZmHOX2a(1) <---------ARR11(2) <------NtERF2--------->At4g35610       <----------DOF2
----------CBF           <---------HSFB2a(2)  ------>NtERF2 <---------At4g35610<---------MYB52(1)   <
 
tattgggctagaggaaatggaatgggtctagatacggcccaataaaggcgcgagatagagacaactgaagtcttgtttcctgttatttcttttgattttg  24019300
                                                                      xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                                     <---------At4g35610
                                                                     --------->At4g35610    <-------
                                                                     --------->ZAT2     --------->AHL12(2)
                                                                --------->bZIP60(2)   <---------AHL20(2)
                                                             xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                            xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                        --------->MYB52(1) ----------->HVH21         <---------AHL20(2)
                                       <---------ATHB12   <---------WOX13(1)     <----------DOF2
            --------->AHL20(1)--------->WOX13(2)        --------->ATHB12--------------->AtSPL8
      --------->TOE2(3)       <---------WOX13(2)     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2) <---------AHL20(2)
    --------->RVE1(2)  --------->At4g35610         xxxxxxxxxxxxxxxx>smallRNA(s)  <---------DAG2  <--
-----------GT1         <---------At4g35610       <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)--------->AHL25(3)
 
ttttactaatctaaatatactaaatcagcagtcaattttccaataactgatgcattcagtgattgacacatcagcttagtactacttttttattttttca  24019400
                                                                                xxxxxxxxxxxxxxxxxxxx
                                                                                xxxxxxxxxxxxxxxxxxxx
                                                                               <xxxxxxxxxxxxxxxxxxxx
                                                                               xxxxxxxxxxxxxxxxxxxxx
                                                                               <xxxxxxxxxxxxxxxxsmallRNA(i)
                                                                               <xxxxxxxxxxxxxxxxxxxx
                                                                              xxxxxxxxxxxxxxxxxxxxxx
                                                                              <---------GATA12
                                                                              <xxxxxxxxxxxxxxxxsmallRNA(i)
                                                                              <xxxxxxxxxxxxxxxxxxxxx
                                                                              <xxxxxxxxxxxxxxxxxxxxx
                                                                              --------->GATA12
                                                                              xxxxxxxxxxxxxxxxxxxxxx
                                                                             xxxxxxxxxxxxxxxxxxxxxxx
                                                                            xxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                                           <---------ALFIN1
                                                                         <xxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                        <xxxxxxxxxxxxxxxxsmallRNA(i)
                                                                        ------>ZmHOX2a(2)
                                                                       xxxxxxxxxxxxxxxx>smallRNA(i)
                                                                       <------ZmHOX2a(2)
                                                                       --------->GLK1(1)
                                                                      <---------GATA12
                                                                      --------->ARR14(2)
                                                                      --------->ARR11(3)
                                                                      --------->RVE1(2)
                                                                      <---------ARR14(2)
                                                                      <xxxxxxxxxxxxxxxxsmallRNA(se3)
                                                                      <---------ARR11(3)
                                                                      --------->GATA12
                                                                     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                                     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
                                                                    xxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                                    xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                                   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                                                   <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                                                                   xxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                                                                  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                                  xxxxxxxxxxxxxxxx>smallRNA(i)
                                                                  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                                  <---------ALFIN1
                                                                  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
                                                                  <xxxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
                                                                 xxxxxxxxxxxxxxxxxx>smallRNA(si3)
                                                              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                                                            <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                            <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
                           <-----------GT1                 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                          <---------AHL20(2)              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)
                        --------->WOX13(2)               xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
                        <---------WOX13(2)               <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                       <------------------------ANAC81   <----------DOF2xxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
                      <---------AHL20(2)                 <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                <---------ANAC58                         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)    <x
                <---------ANAC46                        <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)    ---
                <---------ANAC58     --------->KAN1     xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)    <--
              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) <-----------GT1xxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)
              xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)  xxxxxxxxxx
         xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)     <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3) xxxxxxxxxxx
  --------->ANAC58   --------->AHL25(3)         xxxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)<----------DOF2
  --------->ANAC58 <---------DOF5.7(1)      xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)     <---------DAG2
<-----------GT1---------->ID1 <----------DOF2 xxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)   xxxxxxxxxxxxxxxx
----GT1  xxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3) xxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)  <---------ALFIN1<
-------ICU4 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(se3)  <---------KAN1xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)
 
tttttacgcatagtatgtgtcgtttttatttaactttgtttcattctcaaacgattttctctttcatccccacgatctccacatctccactttctctctt  24019500
             <---------ZAT14
         --------->YAB5
<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
xx>smallRNA(fl3)
xxx>smallRNA(si3)
xxxsmallRNA(se3)
xx>smallRNA(se3)                                                                          <---------WOX13(2)
xxsmallRNA(fl3)                                                              <----------DOF2
x>smallRNA(fl3)                                                            <-------TEIL   --------->WOX13(2)
xxsmallRNA(si3)                                                          <---------MYB52(1)<--------
xxsmallRNA(se3)                                           <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
x>smallRNA(se3)        <---------ARR11(3)                xxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
>smallRNA(fl3)xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)       <xxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)                     --------->YAB5 --------->MYB59  xxxxxxxxxxxx
------>HSFB2a(2)       --------->ARR11(3)         <---------YAB1       <---------------AtSPL8     --
-------HSFB2a(2) ----------->GT1                 --------->TOE2(3)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(i2)
xxxxxxxxxxx>smallRNA(i2)    ---------->DOF2     <---------ICU4     <---------GLK1(1) --------->At4g35610
xxxxxxxxxxx>smallRNA(i2) --------->TOE2(3)      --------->YAB5     --------->GLK1(1) <---------At4g35610
xxxxxxx>smallRNA(si3)  --------->RVE1(2)       <---------YAB1   xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(fl3)
xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)  <---------GLK1(1)  xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3) ------
 
ccaaaaactccatgactactgtgtaaaatctcaaagatgggtttctcaacatcattaatcgattactcagaaatcaggtactttgttcatctcaatgaac  24019600
                                                                   --------->YAB1
                                                              <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(fl3)
                                                             --------->LBD16
                                                            <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                                           ========================HOX2a_HOX2a
                                                           ------>ZmHOX2a(2)
                                                          --------->CCA1(2)
                                                          <------ZmHOX2a(2)
                                                          =========================HOX2a_HOX2a
                                                         <---------ARR14(2)
                                                         --------->GATA12
                                                         <---------ARR11(2)                      <--
                                                         <---------GATA12                       <---
                                                       ----------->ARR10<-----------GT1         <---
  <---------At5g28300                         <---------GLK1(1)  --------->RVE1(2)<---------HSFB2a(2)
 <-----------GT1                      --------->AHL20(2) --------->AGP1--------->KAN1--------->GATA12
-ATHB12                               <---------AHL20(2) --------->ARR11(2)       --------->HSFB2a(2)
xxxxxxxxxxx>smallRNA(si3)             <---------AHL12(3) <---------RVE1(2)       <xxxxxxxxxxxxxxxxxx
------->WOX13(2)                      --------->AHL12(3)--------->KAN1 <---------CCA1(2)       <----
->TEIL                              <---------------AGL15--------->ARR14(2) ------>ZmHOX2a(1)  <----
 
caatttaccatcttctatttttgtttgtaattttgttttatatatatagaattctccatagatccgaaaatcatatatccttcttctagatttctatggc  24019700
<- Previous    Next ->

AGI:  At5g59560.1   
Description:  SRR1 (SENSITIVITY TO RED LIGHT REDUCED 1). Identical to Protein SENSITIVITY TO RED LIGHT REDUCED 1 (SRR1) [Arabidopsis Thaliana] (GB:Q8GWZ6;GB:Q9LTH5); similar to hypothetical protein [Vitis vinifera] (GB:CAN76600.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO67341.1); contains InterPro domain SRR1 (InterPro:IPR012942)
Range:  from: 24017782    to: 24019157    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version