AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                    <---------AHL20(2)
                                   --------->AHL20(2)
                              --------------->AGL15
                            ------->TEIL
                           <-----------GT1
                     --------->AHL12(1)
                     <---------AHL25(3)
                     <---------AHL12(1)
                     <---------AHL25(1)
                     <---------AHL12(3)
                    --------->AHL12(1)
                    <---------AHL12(2)
                    <---------AHL12(1)                  <---------ZAT2
                    --------->AHL12(2)                  --------->At4g35610
                    --------->AHL25(2)                  <---------At4g35610
                    --------->ARR11(3)                <---------DEAR3(1)
                    <---------ARR11(3)               --------->SPL7(1)
                    <---------AHL20(1)               --------->RAP2.6(3)
    --------->At4g35610 --------------->AtSPL8      --------->MYB52(1)
    <---------At4g35610 <---------------AtSPL8  --------->MYB52(1)
-----AHL12(2)       <---------AHL25(2)      ==================================HOX2a_HOX2a
-----YAB1           --------->AHL20(1)      <------ZmHOX2a(2)
--->AHL12(2)        --------->AHL25(3)     --------->GATA12
-->ATHB51          --------->AHL12(3)      <---------GATA12                                      <--
--HAHB4            --------->AHL25(2)      <---------ARR11(3)                                    <--
---ICU4            --------->AHL12(2)      --------->RVE1(2)                                    ----
->ICU4             <---------AHL12(2)      --------->ARR11(3)           <---------TOE1(2)      <----
--YAB1             <---------AHL12(3)    --------->DOF5.7(1)            <---------TOE2(2)     <-----
--YAB5             <---------AHL25(2)--------->YAB1<---------SPL7(1)   ------>ZmHOX2a(1)      <-----
 
taatctcagcccaaaacataaaaaatatttgtaccctatataataagatcgaaacggacggctgagattgcatcctatgttttgcagttttttgagtcgg  23918400
                                          <---------TOE2(3)
                                          <---------YAB1
                                      <---------WOX13(2)
                                    <---------AHL20(1)
                                    --------->AHL20(3)
                                    <---------AHL25(3)
                                    --------->AHL20(2)
                                    --------->AHL12(1)
                                    --------->AHL20(1)            <---------MYB52(2)
                                    <---------AHL12(1)       --------->ANAC55(2)
                                    <---------AHL20(2)       ----------->GT1
                                    --------->AHL25(2)       <---------ANAC55(2)
           --------->DOF5.7(1)      <---------AHL20(3)      <-------TEIL
          --------->DOF5.7(1)       --------->AHL25(3)    --------->ARR11(2)
          --------->DAG2            <---------AHL25(2)    <---------ARR14(2)
   --------->ARR14(2)               --------->AHL25(1)    <---------RVE1(2)
   <---------GATA12           --------->ANAC58            <---------GLK1(2)
   --------->GATA12           <---------ANAC55(2)         --------->ARR14(2)
   <---------ARR11(2)         ----------->GT1             <---------GATA12
   --------->ARR11(2)         --------->ANAC55(1)         --------->GATA12<---------ANAC46
   <---------ARR14(2)         --------->ANAC55(2)         <---------ARR11(2)            <-----------GT1
   --------->GLK1(2)          --------->ANAC46     <---------ANAC46   --------->At4g35610
-------WRKY12      --------->DOF5.7(1)--------->WOX13(2)  --------->ARR11(1)         <---------DOF5.7(1)
-------WRKY38(1)   --------->DAG2   <---------AHL25(1)   --------->KAN1   <---------ANAC58    <-----
----->WRKY18(1)   --------->DOF5.7(1)<---------AHL12(2)<--------P<---------WOX13(2) <---------DOF5.7(1)
-------HVH21     ---------->DOF2   --------->AHL25(3)----------->GT1  <---------At4g35610<---------LBD16
-MYB46(1)---------->DOF2      --------->ANAC58 --------->REM1(2) --------->WOX13(2) <----------DOF2
-MYB83 --------->LBD16 <----------DOF2<---------AHL12(2)----------->ARR10 <---------ANAC58<---------ANAC46
 
tcatcgaatccgaaaagcggaaaaggctttctcacgtaataaattaagcttgtagagggtagattcgtaactaagcagcgtgttttccttttttcgggtt  23918500
                                  <---------ANAC46
                                --------->ARR14(2)
                              --------->LBD16
                       <---------AHL25(1)
                       <---------AHL20(2)
                      <---------AHL20(2)
                      --------->AHL25(3)
                      --------->AHL20(2)
                      <---------AHL25(2)
                      --------->AHL25(2)
                ------------>CBF<---------ARR14(2)
             --------->MYB46(3) <-----------HVH21
            ---------->DOF2  <---------ANAC46
         --------->LBD16     <---------ANAC58                         <----------DOF2
        <---------HSFB2a(2)  <---------ANAC58                       <------NtERF2
        --------->HSFB2a(2) <---------LBD16                  ---------->DOF2
     --------->ARR11(2)<---------YAB1                     ----------->GT1            <----------DOF2
--------->GLK1(2)     --------->AHL12(3)             <---------AHL20(2)       <-----------GT1
<---------ARR11(2)    <---------AHL25(1)             <---------AHL12(3)     <-----------HVH21    <<<
--------->ARR14(2)    --------->AHL25(1)           ----------->TBP--------->ZAT18 --------->ANAC46
<---------ARR14(2)    <---------AHL12(3)      --------->TOE2(3)   <---------ZAT18--------->MYB46(3)
---P --------->PCF2  --------->YAB1 ----------->GT1<---------------AGL15 <----------DOF2       <----
 
gagaatcggacccagaacagccaattttaattccgggtcgggttataaacctctatatatatggtaaagcccgcttctttgtcacccgcttcacgatttc  23918600
                                                                     <---------AHL12(2)
                                                                   --------->AHL12(1)
                                                                   <---------AHL12(1)
                                                                   --------->YAB1
                                                                   <---------AHL20(3)
                                                                   --------->AHL12(3)
                                                                   <---------AHL12(3)
                                                                   --------->AHL20(3)
                                                                   <---------AHL20(2)
                                                                   --------->AHL20(2)
                                                                   <---------AHL25(1)
                                                                   --------->AHL25(1)
                                                                  --------->ICU4
                                                                  <---------YAB5
                                                                 <---------WOX13(2)
                                                                 --------->WOX13(2)
                                                                >>>>>>>>>GT-2                   ----
                                                              --------->At5g28300       <---------TOE2(3)
                                                             ----------->GT1        <---------WOX13(2)
                               ---------->DOF2            --------->MYB52(1)        --------->WOX13(2)
                              <---------ATHB12           <---------SPL7(1)         --------->WOX13(1)
                  ------------>CBF                    ------>ZmHOX2a(1)           --------->AHL20(2)
      ---------->ID1  <---------ATHB12   <----------DOF2----------->HVH21        <---------ATHB12
<<<<<<<<<TBF1 ---------->ARF1<---------WOX13(2)      --------->TOE1(2)         --------->WOX13(1)
<<<<<<TBF1<---------DOF5.7(1)--------->WOX13(2)     ----------->RAV1(2) <-----------GT1 <---------TOE1(3)
--------------------ANAC81------------>CBF ------------>CBF--------->SPL7(1) ------------>CBF   ----
 
ttcttcttcgtcgtcttctctcccaatcgtccaattaagctctgctttcaatttctcctgcgaacggtaattatataactctcaatcaattagggtttca  23918700
                                                            <----------DOF2
               <---------bZIP60(1)                   <------MYB46(1)
               --------->ANAC46  ----------->GT1     <------MYB83                               ----
               --------->bZIP60(1)                  --------->MYB59                            -----
       <---------ALFIN1   <---------ANAC46       --------->WOX13(2)                       ------->GAMYB
      --------->LBD16 <----------DOF2<-----------TBP<---------TOE2(3) --------->RVE1(2)  --------->MYB46(3)
----->ANAC58   ==================bZIP_DOF     ------------>CBF    <---------YAB5<---------ZAT6 <----
----->ANAC58   --------->TGA1a <------------CBF  <---------WOX13(2)----------->GT1   <---------YAB1
 
aggaaaacccccaaactcacatcacctttgagtgaattgtatttatactctcaattaggttttctttgaatcgtatcaagatggtgttatcaacgagcga  23918800
                                                           <---------ETT(2)
                                                           --------->ETT(2)
                                                          ---------->ARF1
                               --------->DOF5.7(2)    ------>ZmHOX2a(2)
                             --------->bZIP60(1)     <------ZmHOX2a(2)
                             <---------bZIP60(1)    --------->ARR11(3)
                            ----------->STF1        <---------RVE1(2)
----->CCA1(2)              <---------TGA2(2)        <---------ARR11(3)              <---------ZAT14
---->ARR11(2)             ----------->HVH21         <---------GATA12  --------->ARR11(3)
-----ARR11(2)             ----------->TGA1          --------->GATA12  <---------ARR11(3)
 
tacgagtagctcttacaactatgttatcgatgacgttatcaacaagtctcgatgcgatcttgtctacaatggagaacttgatgagagtgttcttagccaa  23918900
                                                       --------->ARR14(2)
                                                       <---------ARR14(2)
                                                       <---------ARR11(3)
                                                       <---------RVE1(2)
                                             --------->YAB5
                                            <---------KAN1
                                          <------ZmHOX2a(1)         --------->ATHB12
                                 <---------TOE2(3)     --------->ARR11(3)
                                 <---------TOE1(3)    <------ZmHOX2a(1)                      <------
        --------->MYB52(2)    <<<<<<<<<MYB98<---------YAB1   --------->HSFB2a(2)<----------DOF2
      <--------P      <----------DOF2   <---------TOE2(3)    <---------HSFB2a(2)<---------DAG2
      <---------MYB52(1)     <---------WOX13(2)    <---------At4g35610<---------WOX13(1)     <------
 
attcaatcggttagtttgttaactcctttgtaagttagggttttaggatgattcagaggattttctgaaactgattgaaaaaactttatgtctatagatg  23919000
                                                                                  <---------ZAT18
                                              --------->ARR11(3)                  --------->ZAT14
                                              <---------ARR11(3)             <---------RVE1(2)
                                            --------->HSFC1(2)         --------->TGA1a
                                    --------->MYB46(3)                 <---------TGA1a
                                    --------->KAN4(1)                  ----------->RAV1(2)
                     <------ZmHOX2a(1)      <---------HSFC1(2)       <---------ALFIN1
                    --------->At4g35610 --------->YAB1             --------->AtMYB61
                --------->ANAC58    <---------KAN1                 <---------ALFIN1
                --------->ANAC58    --------->KAN1                --------->MYB46(3) <---------At4g35610
                --------->ANAC46    <---------HSFB2a(1)           --------->ANAC46<---------ZAT14
---RVE1(2)  --------->CCA1(2)      <---------KAN4(2)            --------->ANAC46  --------->ZAT18
---GATA12<---------YAB1       --------->At4g35610    <---------At4g35610   ----------->HVH21
 
tggaaaacgaagatgatacaagcaggagccatgagcggaacaatcgaaacatcttctgcttcgattcccaccacacctgtgatagtgcagacgactcttc  23919100
                                                                       --------->TOE2(3)
                                                                  --------->KAN1
                                                                 <---------AHL25(1)
                                                                 --------->AHL25(2)
                                                                 <---------AHL20(1)
                                                                 <---------AHL20(3)
                                                                 --------->AHL20(1)
                                                                 <---------AHL20(2)
                                                                 --------->AHL20(3)
                                                                 <---------AHL25(3)
                                                                 <---------AHL25(2)
                                                                --------->AHL20(2)
                                                               <---------YAB1
                                                            <---------AHL20(3)
                                                            <---------AHL25(1)
                                                            --------->AHL20(3)
                                                            --------->AHL25(3)
                                                            <---------AHL25(2)
                    --------->TOE2(2)                       --------->AHL25(2)
               <----------DOF2               --------->DOF5.7(1)--------->YAB1
     <---------GATA12          <---------ARR11(3)           --------->AHL25(1)
     <---------ARR11(2)        --------->ARR11(3)           <---------AHL20(2)                  ----
     --------->ARR11(2)     <---------------------WRI1   <---------RVE1(2)                   <------
   --------->LBD16  --------->TOE1(2)      ---------->DOF2  --------->AHL20(2)             ---------
 <---------LBD16   ----------->RAV1(2) ---------->DOF2<---------WOX13(1)------>ZmHOX2a(1)  ---------
 
agactccggatgcaattcctttacctgagaagaagatgtctccaaagaaagagagtgatggattttattatattcctcagcaagatggagcgagagatga  23919200
                                                      <------ZmHOX2a(1)
                                                --------->YAB5
                                               <---------YAB1             <---------YAB1
                                               --------->ICU4           --------->YAB5
                                             --------->YAB1             --------->YAB1
                                             --------->YAB5            <---------YAB1
                                            --------->ICU4             --------->ICU4
--->TEIL                                    <---------YAB1           --------->YAB5
---REM1(1)                                --------->YAB5             --------->YAB1             <---
>CCA1(2)<---------REM1(1)                 --------->YAB1     --------->ARR11(3)   ------->TEIL <----
>At4g35610          <---------KAN1     <------ZmHOX2a(1) <---------At4g35610 --------->CCA1(2) <----
 
agctattgtcgatgtagatgagaatgaagagcctttgaacgaggatgatgatgatgaggaagatgatatcgatgatgatgatatgaacattcaacatttg  23919300
<- Previous    Next ->

AGI:  At5g59230.1   
Description:  transcription factor-related. similar to transcription factor IIA large subunit / TFIIA large subunit (TFIIA-L) [Arabidopsis thaliana] (TAIR:AT1G07480.2); similar to transcription factor IIA large subunit, putative / TFIIA large subunit, putative [Arabidopsis thaliana] (TAIR:AT1G07470.1); similar to transcription factor IIA large subunit / TFIIA large subunit (TFIIA-L) [Arabidopsis thaliana] (TAIR:AT1G07480.1); similar to Os05g0292200 [Oryza sativa (japonica cultivar-group)] (GB:NP_001055101.1); similar to hypothetical protein OsJ_017149 [Oryza sativa (japonica cultivar-group)] (GB:EAZ33666.1); contains InterPro domain Transcription factor II
Range:  from: 23918781    to: 23919605    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version