AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                            <---------ANAC46
                                                            <---------ANAC58
                                                            <---------ANAC58
                                                       --------->ATHB12
                                                      <---------YAB5
                                                  <---------YAB1
                                                 --------->AHL12(2)
                                                 <---------AHL12(2)
                                                <---------AHL12(1)
                                                <---------AHL25(3)
                                                <---------ICU4
                                                -------->ATHB1
                                               <---------ATHB51
                                               <---------AHL25(2)
                                               --------->AHL20(3)
                                               --------->ICU4
                                               <---------AHL20(2)
                                               --------->AHL20(2)
                                               <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3)
                                               --------->AHL12(1)
                                               <---------AHL12(1)
                                               --------->AHL25(3)
                                               <---------AHL20(3)
                                               --------->AHL25(1)
                                               --------->AHL25(2)
                                            <---------AHL20(2)   <---------ARR11(2)
                                            --------->AHL20(2)   <---------RVE1(2)
    <---------WRKY18(1)        ----------->GT1 <---------AHL25(1)<---------ARR14(2)
 <---------ANAC58         <---------YAB1   --------->AHL20(2)    --------->ARR11(3)
 <---------ANAC58    ------->TEIL     <---------YAB5 <---------TOE2(3) <---------ANAC46      <------
----->AtMYB61<----------DOF2<---------RVE1(2) --------->AHL12(2) --------->ARR14(2)----------->GT1
 
caatgcttgagcgaaactttgatgaaactctgatttgtataatcttttaaattattaatgtttgagtggatattgggtttacaaatttgttaaaaacttt  23636300
                        <---------TOE2(3)
                        --------->DOF5.7(1)
                        <---------TOE1(3)
                       --------->MYB52(1)
                    --------->WOX13(2)
                    <---------WOX13(2)
                   <---------------AGL15
                   --------->WOX13(1)
             <---------AHL25(3)
             <---------AHL25(1)
             --------->AHL25(1)
             <---------AHL20(3)                                         --------------->AtSPL8
             --------->AHL20(3)                                      --------->AHL20(2)
             <---------AHL20(2)                                   --------->YAB5
             --------->AHL12(3)                                  --------->ICU4       <---------AHL25(2)
             --------->AHL20(2)                                  <---------YAB1       <---------AHL20(3)
             --------->AHL25(2)                   --------->AHL20(2)<---------YAB1    --------->AHL20(3)
            --------->YAB1----------->GT1    --------->AHL20(2)--------->ANAC55(2)    --------->AHL25(2)
            --------->AHL25(1)             <---------ANAC46    <---------ANAC55(2)   --------->YAB1
            --------->AHL20(2)           ----------->GT1      <-------TEIL        --------->YAB1
---------->DOF2 --------->RVE1(2)    --------->DAG2      --------->AHL20(2)<-----------GT1
----DOF2  <---------WOX13(2)        ---------->DOF2 <---------AHL12(2)  <---------------AtSPL8     <
 
ggtgaaagtagagaattaaaatcaattaagggtaacaaataaagttgtttatataaaatataaaatacatgattatatgtacaattcataatattagtat  23636400
                              ----------->HVH21
                          <---------ANAC55(2)
                          --------->ANAC55(1)
                          --------->ANAC55(2)
                    <---------AHL25(3)
                    --------->AHL25(3)
                    <---------AHL25(1)
                    --------->AHL25(1)
                    --------->AHL20(2)
                    --------->AHL12(3)
                    <---------AHL12(3)
                    --------->AHL20(3)
                    <---------AHL20(2)
                  <---------AHL12(2)
                 <---------AHL12(2)
                --------->AHL25(2)
                <---------AHL12(3)
                --------->AHL12(3)
                <---------AHL25(3)
                --------->AHL12(1)
                <---------AHL12(1)
               --------->AHL25(1)
               <---------AHL12(3)
               --------->AHL12(3)                                                  <---------ANAC46
               --------->AHL25(3)                                                --------->MYB52(1)
               --------->AHL12(1)                                           --------->ARR11(3)
               <---------AHL20(2)                                           <---------RVE1(2)
               <---------AHL25(3)                                           <---------GLK1(2)
               --------->AHL25(2)                                     <---------AHL20(2)
               <---------AHL25(1)                                     <---------AHL25(3)
               <---------AHL25(2)                                    --------->AHL25(1)       ------
               <---------AHL12(1)                                    <---------AHL12(3)      -------
               --------->AHL20(2)              <---------ARR11(3)    --------->AHL25(3)      -------
              --------->AHL25(3)               --------->ARR11(3)    <---------AHL25(1)      <------
              --------->AHL12(2)               --------->RVE1(2)     --------->AHL12(3)      -------
              --------->AHL25(1)              --------->CCA1(1)      --------->AHL20(2)      <------
              <---------AHL25(2)            <---------AHL20(3)       <---------AHL20(2)     <-------
              <---------AHL12(3)            --------->AHL12(3)       <---------AHL12(1) --------->KAN1
     <---------HSFB2a(2)  <---------ANAC55(1) --------->RVE1(1)      --------->AHL12(1) --------->YAB5
     --------->HSFB2a(2) <-------TEIL       --------->AHL20(3)      --------->AHL12(2) <---------KAN1
---------YAB1 --------->AHL20(2)        <---------KAN1         ----------->GT1  ----------->HVH21
 
atatgatactagaagaaaaaaatttaaatacgtatgacaccgagtataaatatctaatgcaaaatacagaaaataaatagatactgacggataattccgg  23636500
     <---------TOE1(3)             --------->ARR14(2)
     <---------TOE2(3)             <---------ARR14(2)
--->LBD16                          --------->ARR11(2)
-->ANAC55(2)                    <---------HSFB2a(2)
-->ANAC46                   <---------GATA12                                          <---------KAN1
---HSFB2a(2)       <-----------GT1 <---------ARR11(2)                             <---------ANAC46
-->HSFB2a(2) <---------TOE2(3)  --------->HSFB2a(2)                      --------->ANAC58
---ANAC55(2)<-----------GT1--------->KAN1 --------->ZAT14                <---------ALFIN1
--LBD16    <-----------GT1---------->DOF2<---------MYB52(1)              --------->ANAC58
 
aacacatgaaggttttaacatttaacccataaatcccagaacccgttcagtatttgaatttagtttttttatggccacgctcgtttcgagtttgggcctg  23636600
                 ----------->RAV1(1)
              --------->ANAC46
          <-----------GT1                        <---------At4g35610
      <---------AHL20(3)               <---------AHL25(1)
      --------->AHL20(3)               <---------AHL20(3)
      --------->AHL20(2)               <---------AHL20(2)
      <---------AHL20(2)               --------->AHL20(2)
    --------->AHL12(3)             --------->AHL12(3)
    --------->AHL12(2)             --------->AHL20(2)
    <---------AHL12(2)             ----------->TBP
    <---------AHL12(3)           <-----------TBP --------->At4g35610
  <---------RVE1(1)            --------------->AGL15                --------->YAB1
  <---------CCA1(1)           ----------------->AGL3      --------->WOX13(2)
 <---------ARR11(3)     --------->YAB5 <---------AHL12(3) <---------WOX13(2)  --------->YAB1     ---
 <---------RVE1(2)    --------->RVE1(2)----------->TBP--------->ANAC55(2)--------->TOE1(3)   -------
 
gctggatatttttttacccacaacaaatctctacccatatatataaatgggcctctcacttaataagcccataataccctaacatcatggagttggaaga  23636700
                                                                                                 ---
                                                                                                 <--
                 <---------TOE1(3)                                                               <--
             --------->WOX13(2)                                                                  ---
          <-----------------AGL2                                                            <------ZmHOX2a(2)
          ------------>CBF                                                                 <--------
          ----------------->AGL1                                                           <--------
   <---------AHL20(2)                                                                      <--------
   <---------AHL12(3)      --------->ANAC55(2)              --------->ZAT2                 ---------
   <---------AHL25(1)      <---------ANAC58                 --------->At4g35610            ---------
   <---------AHL20(3)      <---------ANAC58           <---------ARR11(2)                   ---------
   --------->AHL20(2)     ------->TEIL <---------DOF5.7(1)  <---------ZAT2          <---------MYB46(3)
   ----------->TBP    <---------------AtSPL3       --------->ALFIN1                 --------->MYB111(2)
 <-----------TBP <---------TOE2(3)    <---------DOF5.7(1)   <---------At4g35610    <--------P------>ZmHOX2a(2)
-------->GT1 <---------WOX13(2)       <----------DOF2 --------->ARR11(2)          <---------MYB52(1)
-->DOF5.7(1)--------->WOX13(1) *TSS   <---------DAG2<---------MYB46(3)       ----------->RAV1(1)<---
 
gggtatataaatggccaattagggttttgtacgtgctctcactttttctctcaagtggttcggagctgtttctaagaaaacaacaggtagttcggatcgg  23636800
------>ZAT2
-------ZAT2
-------At4g35610                                                  --------->ATHB12
------>At4g35610                                           --------->At4g35610
-GATA12                                                    <---------At4g35610            ------>ZmHOX2a(1)
-ARR14(2)                                                  --------->ZAT2                --------->TOE2(3)
-ARR11(2)                                                  <---------ZAT2                --------->TOE1(3)
>ARR14(2)                                             ----------->RAV1(2)   <---------GATA12
>ARR11(2)                         ------>ZmHOX2a(1)   <---------At4g35610   --------->GATA12
>GATA12                     <---------YAB5       <----------DOF2 <---------YAB5          --------->ANAC55(2)
--------ARR10            <-------TEIL           <---------DOF5.7(1) <---------WOX13(1)   <---------ANAC55(2)
 
agctacgcttgcaaaactcaaaacatggttcgtcatcctctaatctctatctctttcttctgagcttagtgattgtttacatctagatagttccttaact  23636900
                    <---------ZAT6
              <------MYB46(1)
              <------MYB83                                                           <---------AHL20(2)
             <---------MYB46(3)                                                    <---------YAB1
            <---------ANAC46                                             <---------ANAC58
            <--------P                                          <---------RVE1(2) <---------AHL25(2)
           <---------MYB52(1)                                  --------->YAB5     --------->AHL25(2)
         <-----------RAV1(1)                                   --------->ATHB12   <---------AHL20(3)
        <---------ANAC46                                       --------->KAN1     --------->AHL20(2)
      --------->ARR11(2)                                     <---------WOX13(1)   --------->AHL20(3)
      <---------ARR11(2)                                   --------->ATHB12----------->GT1
      --------->ARR14(2)                                  <---------AHL20(2)    --------->ICU4     -
      <---------ARR14(2)       <---------ANAC46           <---------YAB1 <---------ANAC58         <-
 
cgactctcgtttctggtgggtttgtgttagagtgacttagagaatgggttttgttagcaatttgattgattcgataacttgtgaatattatatgcatcat  23637000
                          <---------ARR11(3)
                     <---------WOX13(2)
                 <---------At4g35610
            --------->CCA1(2)
           <---------ARR14(2)
           --------->ARR11(3)
           <---------ARR11(3)
           --------->AGP1 <---------AGP1
           --------->ARR14(2)
           <---------AGP1 --------->GATA12
           --------->ARR11(2)
           <---------RVE1(2)
           --------->GATA12
           <---------GATA12 ------>ZmHOX2a(2)             --------->YAB5                         ---
           <---------ARR11(2)           <---------At4g35610 <---------YAB1                 ---------
          <---------CCA1(2)<------ZmHOX2a(2)              --------->YAB1                   <--------
         ----------->ARR10<---------GATA12               <---------YAB1                    ---------
       ===========================HOX2a_HOX2a            --------->ICU4                 --------->YAB1
       =============HOX2a_HOX2a      <-----------HVH21 <---------ICU4                 ------>ZmHOX2a(1)
       ------>ZmHOX2a(1)  --------->ARR11(3)           --------->YAB1                --------->TOE1(3)
       ============================HOX2a_HOX2a        <---------YAB1                 --------->TOE2(3)
      --------->TOE2(3)  <---------CCA1(2)      <---------TOE2(3) <-------TEIL   <---------GLK1(1)
<---------RVE1(2)--------->At4g35610--------->ALFIN1  --------->ICU4             --------->GLK1(1)
-------->KAN1------>ZmHOX2a(2)      <-----------RAV1(1)--------->YAB5         <---------YAB5  <-----
--------YAB1<------ZmHOX2a(2)     <---------KAN1--------->MYB59--------->CCA1(2)<---------GATA12 <--
 
ggtgattctccttagatctgagctcattagatctcaaatgtgtcgctgatttaggtcatgatgatgatatacatagcagtagagatttccttaataataa  23637100
                    <---------AHL12(2)
                    --------->AHL12(2)
          --------->AHL25(1)                                   ---------->DOF2
          --------->AHL12(3)                                   --------->KAN1
          <---------AHL25(1)                           --------->DOF5.7(1)                         <
------>ARR11(3)    <---------AHL20(2)               ----------->HVH21                             <-
>YAB5     --------->AHL20(2)                      --------->At4g35610                <---------WOX13(1)
-ICU4     <---------AHL20(2) --------->ANAC46     <---------At4g35610               <---------ANAC58
>YAB1  --------->TOE2(3) <-----------GT1       <---------HSFC1(2)          --------->ATHB12       <-
------GT1--------->AHL25(3)<-----------RAV1(2) --------->HSFC1(2)         <---------YAB5          --
-------ARR11(3)----------->GT1   --------->ALFIN1--------->GLK1(2)  ------->TEIL    <---------ANAC58
 
catctcttaacatttattttgttaaattttacaggcgaggggtttgaagaagcatctgaagaggcttaatgcgcctaagcattggatgcttgacaaactt  23637200
<- Previous    Next ->

AGI:  At5g58420.1   
Description:  40S ribosomal protein S4 (RPS4D). Identical to 40S ribosomal protein S4-3 (RPS4D) [Arabidopsis Thaliana] (GB:Q8VYK6;GB:Q944M1;GB:Q9FGI0); similar to 40S ribosomal protein S4 (RPS4B) [Arabidopsis thaliana] (TAIR:AT5G07090.1); similar to 40S ribosomal S4 protein [Glycine max] (GB:AAM93434.1); contains InterPro domain RNA-binding S4; (InterPro:IPR002942); contains InterPro domain Ribosomal protein S4e, N-terminal and RNA-binding (InterPro:IPR013844); contains InterPro domain Ribosomal protein S4e, N-terminal (InterPro:IPR013843); contains InterPro domain Ribosomal protein S4e, central (InterPro:IPR013845); contains InterPro domain KOW (InterPro:
Range:  from: 23636732    to: 23638320    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version