AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                             --------->RVE1(2)
                                                           ------>MYB83
                                                           ------>MYB46(1)
                                                         <---------MYB59
                                                       -------->P
                                                      ------->GAMYB
                                                     <---------MYB55(2)                           --
                                                     <---------MYB111(1)              <---------AHL25(1)
                                                     <---------MYB111(2)              --------->AHL25(1)
                                                 ------>ZmHOX2a(2)                    <---------AHL12(3)
                                               --------->GATA12                --------->YAB1     <-
                                               --------->RVE1(2)    --------->GLK1(2) <---------AHL25(3)
                                       ------>ZmHOX2a(1) ------->GAMYB    <----------DOF2        ---
>ARR11(3)                          <---------ALFIN1  --------->MYB46(3)   <---------DAG2       <----
>GATA12                  --------->TOE2(2)     <---------GATA12   --------->KAN1      <---------AHL20(2)
-ARR11(3) --------->YAB1--------->YAB1 =================HOX2a_HOX2a<---------GLK1(2)  --------->AHL20(2)
 
tagctagtctcaatcttcatgagacaaacataggtccccctcctctgtctgatctaacaacccaactccaaattctgctttatcagaaattatatgaaat  23494200
                     ------->GAMYB
                     --------->TOE2(3)
                    --------->MYB46(3)               --------->YAB1
           ------>NtERF2                             <--------HAHB4
           <---------ZAT18                           --------->YAB5
        <---------ANAC58                             --------->ATHB12
        <---------ANAC58                            <---------YAB5
       <-----------RAV1(1)                          <---------YAB1                        --------->ANAC46
    <----------DOF2-------->P                       --------->ICU4                   <--------------
   <---------DOF5.7(1)                            --------->YAB1           --------->ZAT2 --------->ANAC58
   <---------DAG2 ------->GAMYB                   <---------ICU4           <---------At4g35610
<-----------GT1  <---------MYB55(2)              <---------YAB5            --------->At4g35610
------->WOX13(2) <---------MYB111(1)          <-------TEIL    <----------DOF2        <--------------
--------WOX13(2) <---------MYB111(2)  <----------DOF2<---------ICU4        <---------ZAT2 --------->ANAC58
------>WOX13(1)  --------->MYB46(3) --------->At4g35610 <---------ICU4  <---------At5g28300---------
-----ATHB12--------->ZAT18          <---------At4g35610<---------YAB1  <-----------GT1   --------->SPL7(1)
 
caattaccttttggtgcccaacaacctccattttccttcagcttcaaggctcatcatcattactactttcaaattcacagctcgattactagtacgacat  23494300
                                                                                       <---------YAB1
                                                                                <-----------RAV1(2)
                                                                            <---------At4g35610
                                                                            --------->At4g35610
                                                                        <---------MYB46(3)
                                               --------->At4g35610      <-----------RAV1(1)    -----
                                            --------->At4g35610        <---------MYB52(1)<---------MYB52(1)
                                            <---------At4g35610     <------NtERF2   --------->GLK1(2)
                                           ----------->RAV1(1)    <---------ARR14(2)--------->ARR14(2)
                                         --------->At4g35610      --------->ARR14(2)<---------ARR14(2)
                                         <---------At4g35610     <------ZmHOX2a(1) <---------GLK1(2)
-AtSPL3                                 ------->GAMYB--------->DOF5.7(1)====================RAV<----
-AtSPL8 ---------->DOF2------->TEIL    --------->MYB46(3)        --------->ATERF1(1)--------->ARR11(2)
-->RAV1(1)--------->DOF5.7(1)     --------->RVE1(2)---------->DOF2<---------ARR11(2)<---------ARR11(2)
 
agacatagacataaagacagagaatggacccaagtagtatcaacagcagcagaagaaagagaattggaggagccgttgttgctgcaggttctgtttggga  23494400
                                --------->ANAC58
                           --------->YAB1                                                     <-----
                        ----------->GT1                                                     --------
               --------->YAB5   --------->ANAC58                                         <----------DOF2
---->ARR11(2)  --------->YAB1   --------->ANAC46                               --------->ANAC58
-----ARR11(2) --------->ICU4  <-----------GT1         --------->MYB52(1)       --------->ANAC58 <---
 
aacgagaatgcagagcgatgatgaagtttgtaataacgccattgttcttcatgttacaaacgaagacaagacttcttctactaagcaaatgactttaaag  23494500
           <------MYB83
           --------->ANAC55(2)
           <---------ANAC55(1)
           <------MYB46(1)
           <---------ANAC55(2)
          --------->MYB111(1)                       <---------TOE1(1)
       --------->WOX13(2)                           <---------TOE2(1)
    <----------DOF2     --------->DOF5.7(1)        --------->SPL7(1)
 ------->TEIL         ---------->DOF2            <-----------HVH21
----TOE2(3)<---------ANAC46                      <---------SPL7(1)
-->DOF2<---------WOX13(2)  --------->CCA1(2)    <---------ANAC58                <------------CBF   -
---ZmHOX2a(1)     <---------WOX13(2)            <---------ANAC58    <---------ATHB12      ----------
 
gatgaaactttattaggtgttaatggaaagagacggacttggaagtctagagcgtccgatgtgaagaacccatcaacgcttgagattgttcgagccaatt  23494600
                                                    <------ZmHOX2a(2)
                                                   --------->ARR11(3)
                                                   --------->GATA12                                -
                                                   <---------GATA12                                -
                                                  <---------GLK1(1)                               --
                                                <------ZmHOX2a(1)                                 <-
                                             ------>NtERF2                                        <-
                                            --------->DEAR3(1)                                   <--
                                           <------NtERF2                                        <---
                                       --------->YAB5------>ZmHOX2a(2)                         <----
                                       <---------TGA2(2)                    -------->HAHB4     <----
                                      ----------->TGA1<-------GAMYB         --------->YAB1     <----
                                 ==========================HOX2a_HOX2a      --------->YAB5     <----
                                 ------>ZmHOX2a(1)--------->GLK1(1)        <---------ATHB12    <----
                   =====================HOX2a_HOX2a<---------ARR11(3)      --------->ICU4      -----
                   <------ZmHOX2a(2)*TSS  ------>NtERF2                    <---------YAB5    <------
                   ====================================HOX2a_HOX2a --------->KAN1           <-------
     ----------->HVH21           ===========================HOX2a_HOX2a    <---------YAB1 --------->ALFIN1
     ----------->TGA1 <------------CBF----------->HVH21           --------->ICU4          <---------KAN1
---------->HVH21   ------------>CBF <---------At4g35610           <---------YAB5--------->DOF5.7(1)<
-->CBF            <---------ARR11(3)--------->At4g35610<---------MYB52(1) <---------TOE2(3) --------
 
ctctgaaggtgacgaagccgagatcaattggtactcctccgatgacgccgaggagatcgttgtctagtagtgattctaatgataagagtccgagtgtgtc  23494700
                                                                                    --------->GATA12
                                                                                    <---------GATA12
                                                                                    <---------ARR14(2)
                                                                                    --------->ARR14(2)
                                                                                  <---------TOE1(2)
                                                                               ------>ZmHOX2a(2)
                                                                              <------ZmHOX2a(2)
    <---------ANAC46                                                         <---------ARR14(2)
   <------NtERF2       --------->ARR14(2)                                    --------->GATA12
 <---------DEAR3(1)    ------->TEIL                                          --------->ARR11(2)
 --------->ALFIN1      <---------ARR14(2)                                    <---------ARR11(2)
 <---------ANAC46      --------->GLK1(2)                                     --------->ARR14(2)
--------->ATERF1(1)    --------->GATA12                                      <---------GATA12
-------->MYB55(2)  ------>ZmHOX2a(2)                                      ------>ZmHOX2a(2)
-------->ABI4(2)  <------ZmHOX2a(2)                                      --------->ARR14(1)
------->ALFIN1    --------->CCA1(2)                                      <------ZmHOX2a(2)
--------DEAR3(1) --------->GATA12                                        --------->CCA1(2)
--------AtMYB61  --------->ARR11(2)                                     <---------ARR11(2)
-----GAMYB       --------->RVE1(2)                                      <---------ARR11(3)
------DEAR3(2)   <---------ARR11(2)                                     --------->ARR11(3)
-----At1g77200   --------->AGP1                                         --------->RVE1(2)          -
-----DEAR4(1)    <---------AGP1<---------ANAC46                         --------->GATA12           <
-----DREB2C(2)   <---------ARR14(2)                                     --------->ARR11(1)         -
-----DEAR3(1)    --------->ARR14(2)                                     --------->ARR11(2)        <-
-----ANAC46      <---------ARR14(3)                                     <---------ARR14(2)        --
---->ETT(1)      <---------GATA12                                       <---------GATA12 <---------AtLEC2
-----HVH21       --------->ARR14(3)                                     --------->ARR14(2)       <--
----RAV1(1)      --------->ARR11(3)                                    <---------HSFB2a(1) ---------
---------MYB46(3)<---------ARR11(3)                     --------->LBD16<---------GLK1(1)--------->ZAT18
->ALFIN1       ----------->ARR10                      <---------LBD16 ----------->ARR10 <---------ZAT14
 
ggtggtggcgaagaaggcaagatctgaatctgtagaggggattgagaagaagactactccgggtcgagttaagaagatccgatcggaggtctgcacgacg  23494800
         --------->At5g28300
        ----------->GT1
        --------->LBD16            ---------->DOF2
  ---------->DOF2                 <------ZmHOX2a(1)
  <---------DOF5.7(2)           <---------TOE2(3)
--------->DOF5.7(2)         <-------GAMYB                                  <---------RVE1(2)
-------->TOE2(3)           <---------ANAC58                           <---------GATA12
-------GAMYB               <---------ANAC58                          --------->GLK1(1)
-------->TOE1(3)        <---------MYB52(1)                           <---------GLK1(1)
--------MYB46(3)       --------->At4g35610<---------ARR14(2) --------->GLK1(2)--------->ANAC58
---->ZmHOX2a(2)        <-------GAMYB ----------->GT1       --------->KAN1  <---------ARR11(2)
----ZmHOX2a(2)         <---------At4g35610<---------ARR11(2)<---------GLK1(2) --------->ANAC58
>ANAC46<---------DEAR3(1)  <---------ANAC46           --------->RVE1(2)    --------->ARR11(2)    ---
 
atcgttaaagccggtgaatttgattcagttgcgttgaggaaagtgaattcgttgccatctccaaattctgagaaatctgatacgaaaacagagcaagaag  23494900
                        --------->LBD16
                       --------->HSFB2a(2)
                       <---------HSFB2a(2)
                    <------ZmHOX2a(2)
                   <---------GATA12
                   <---------ARR11(3)                             ------->TEIL
                   --------->ARR11(3)                             <---------ARR11(2)
                   --------->GATA12                               --------->ARR14(2)
                   --------->ARR14(2)                  <------ZmHOX2a(1)
                   --------->RVE1(2)                  <---------At4g35610
                   <---------ARR11(2)                >>>>>>>GRF7  <---------ARR14(2)
                   --------->ARR11(2)      <------MYB83===============HOX2a_HOX2a
                  --------->HSFB2a(1)      <---------ANAC58       --------->ARR11(2)           <----
                  --------->HSFC1(2)       <------MYB46(1)        <---------ARR11(1)          <-----
           <---------ARR14(2)              <---------ANAC46       --------->RVE1(2)           ------
       --------->YAB1------>ZmHOX2a(2)     <---------ANAC58      <---------CCA1(2)            <-----
   --------->YAB1 <---------HSFB2a(1)     --------->MYB46(2)     <---------ARR14(1)       --------->At4g35610
   --------->ATHB12<---------ARR14(2)     <---------AtMYB61<---------YAB1        --------->ANAC58
   -------->ATHB1 --------->KAN1          --------->MYB111(2)  ------>ZmHOX2a(2) --------->ANAC58
  <---------YAB1  <---------KAN1 <<<<<<<<<WRKY18  <-----------HVH21   --------->At4g35610 <---------At4g35610
------>YAB5--------->ARR14(2)   --------->WRKY18(1) <-----------RAV1(2)    --------->RVE1(2)  ------
 
tgactatcattgagaattcgaagatcccagaagaagtcaaggagtttggtgtttgtcaggagatgatcgtatctgctaaatcaaacgaaaatgagcagat  23495000
         <-----------RAV1(2)                                   --------->DOF5.7(1)
      ------>NtERF2                      --------->DOF5.7(1) ---------->DOF2
     <---------ETT(2)           <---------YAB1              <------ZmHOX2a(1)
-----WOX13(1)                   --------->ICU4           <------ZmHOX2a(1)                       ---
----GATA12                   <---------YAB1            --------->ALFIN1                         <---
--->ARR14(2)      <------MYB83--------->YAB5          <------ZmHOX2a(1)        --------->DOF5.7(1)
----ARR14(2)      <------MYB46(1)  <---------YAB1------------------------>ANAC81   --------->ALFIN1
--->GATA12  <------ZmHOX2a(1)--------->ICU4     <---------At4g35610   --------->ALFIN1     ---------
 
tgacaatggcgaccaggagattggtgatcaagatgattatgaagaagatggagatgaggaggaggaaagagaagtggagaagaagagtgttgatgtgaag  23495100
<- Previous    Next ->

AGI:  At5g58000.1   
Description:  CPL4 (C-TERMINAL DOMAIN PHOSPHATASE-LIKE 4). similar to reticulon family protein [Arabidopsis thaliana] (TAIR:AT4G28430.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO45451.1); contains InterPro domain Reticulon; (InterPro:IPR003388)
Range:  from: 23494637    to: 23496824    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version