AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                    ------>ZmHOX2a(2)     <---------At4g35610
                            <---------YAB1        <---------ANAC58    --------->ANAC46
                          <---------ZAT6          <---------ANAC58    --------->ANAC58
                    <---------TOE2(3)<----------DOF2      --------->At4g35610      <---------YAB5
  <---------KAN1    >>>>>>>>>MYB98<---------ARR11(3)      <---------ZAT2   --------->DOF5.7(1)    <-
-->ANAC58          <-----------GT1<---------RVE1(2)<----------DOF2    --------->ANAC58      --------
-->ANAC58       --------->WOX13(2)--------->ARR11(3)      --------->ZAT2 ---------->DOF2   ---------
aaggagtatcgctagacctatttaacatagtcttattgatctttgtttctattgcttttgcagctcaagaaacacacaaagagggcatcatacatttatt  23235000
                                    <---------AHL25(3)               --------->YAB1
                                    <---------AHL12(1)               <---------ICU4
                                    <---------AHL25(2)              <---------YAB5
                                    <---------AHL25(1)              <---------YAB1
                                    --------->AHL25(2)              --------->ICU4
                                    --------->AHL20(2)             --------->AHL20(3)
                                    --------->AHL20(1)             <---------AHL20(3)
                                --------->AHL20(2)                 --------->WOX13(2)
                                --------->AHL25(3)                 <---------WOX13(2)
                    --------->YAB1 <---------AHL25(2)             --------->YAB5
                   --------->AHL12(1)                            <---------AHL20(3)
                   <---------AHL12(1)                            <---------AHL12(3)
                   <---------AHL20(2)                            --------->AHL20(3)
                  <---------AHL12(2)<---------AHL20(2)           <---------AHL20(2)
                 <---------AHL12(2)--------->AHL12(3)            --------->AHL12(3)
                <---------AHL25(3) --------->AHL12(1)            --------->AHL20(2)                -
                --------->AHL20(2) <---------AHL12(3)            --------->AHL25(1)               <-
               <---------AHL25(1)  --------->AHL25(3)            <---------AHL12(1)               --
               --------->AHL25(1) --------->AHL12(2)             --------->AHL12(1)              <--
               --------->AHL20(2) <---------AHL12(2)             <---------YAB1                  ---
   <---------At4g35610          <---------AHL25(3)           --------->AHL20(2)                 <---
   <---------ZAT2--------->AHL12(2)<---------AHL12(1)      <----------DOF2  --------->KAN1      ----
   --------->At4g35610   --------->ANAC58                 <---------DOF5.7(1)                  <----
---------DOF2  <---------AHL20(2)--------->AHL12(2)  <---------GLK1(2)  <-----------GT1       ------
->KAN1--------->At4g35610--------->ANAC58       --------->YAB1   <---------AHL25(1)          <------
>AHL25(3)      --------->AHL25(3)--------->AHL12(3) --------->KAN1--------->YAB1     --------->GLK1(2)
cctttgagctgcttacaaataaataatcaagcacataaattttttgaaaaatcatatattctctttatataattataacatattcaagtttctgttttga  23235100
-------ICU4                            <---------KAN1                                          <----
------>YAB5                       --------->ANAC55(2)             ----------->RAV1(2)     <---------ANAC58
------YAB1                    ------>ZmHOX2a(2)                <----------DOF2            <---------ANAC46
----->ICU4                  <---------ARR11(3)             <----------DOF2                <---------ANAC58
-----RVE1(2)                --------->ARR11(3)          --------->GLK1(2)      --------->GLK1(2)  <-
--->YAB1                  <---------YAB1               <---------GLK1(2)     --------->KAN1<--------
---YAB1<---------AHL20(2) <---------YAB5              --------->KAN1------>ZmHOX2a(1)  <---------WOX13(1)
taattaggatttttttgtttgtttgttttatgatctcacataatatgtctggctgtaagattctttctttcctggccttgaaattctctaattgctttta  23235200
                    --------->AHL12(3)          --------->KAN1
                    <---------AHL12(3)         <---------AHL20(2)
                    --------->AHL25(3)         <---------YAB1
                    <---------AHL25(3)         --------->AHL12(3)
                  <---------WOX13(2)           --------->AHL20(3)
         --------->MYB46(3)<---------CCA1(2)   <---------AHL20(3)    <---------ICU4
-----TOE2(3) ----------->GT1   <----------DOF2 <---------AHL25(1)    --------->YAB1   <---------DAG2
--------AHL20(2)  --------->WOX13(2)--------->YAB1         --------->ETT(2)     --------->TOE2(3)  -
--DOF2  >>>>>>>>>>>>>>>>>LFY <---------YAB1  --------->AHL12(2)     <---------YAB5    <----------DOF2
tgttattgaagaaccaatgtaaattaaatcttatctttatcatgtgttatattattctatggtcgtcagtaatcttcactaatccataactttatttctc  23235300
                            --------->AHL20(2)                                                  ----
                            <---------AHL20(2)                                            --------->GLK1(2)
        --------->YAB1    <---------WOX13(2)                                              --------->ARR11(3)
       <---------YAB1  <---------YAB5                                                     --------->RVE1(2)
   <----------DOF2     ---------->ID1                                            --------->AtMYB61<-
   <---------DAG2<---------DAG2            ----------->GT1             --------->YAB1     <---------GATA12
<-----------GT1  <----------DOF2     <-----------HVH21                <---------YAB1      <---------ARR11(3)
--------->ID1 <-----------GT1 ---------->DOF2                      <---------AHL12(1)     --------->GATA12
ttgtcactttatgatataaactttttgtcatttaaaagtctgtcagaggtaaaaacaaaaacaaaaacaaaaaatcatagtaaaccaaaacaaaatctag  23235400
                                        --------->RAP2.6(3)    <---------ZAT2                  -----
                                       --------->DOF5.7(1)     <---------At4g35610    <---------ANAC46
                                       --------->MYB52(1) --------->DOF5.7(1)         <---------AtLEC2
                                       *TSS             --------->DAG2 <---------DOF5.7(1)     <----
                             <---------ARR11(2)        --------->DOF5.7(1)            <---------ANAC58
                             --------->ARR11(2)       --------->DOF5.7(1)<---------DOF5.7(1)   -----
     --------->MYB52(1)--------->ARR11(2) ----------->GT1--------->DAG2<---------DAG2 <---------ANAC58
----->YAB1             <---------ARR14(2)<----------ID1---------->DOF2 --------->TOE2(3)----------->HVH21
--------KAN1     --------->DOF5.7(1)  --------->DOF5.7(1)--------->DOF5.7(1)<-----------GT1   ------
aataaacaaaacggagtcgtaagagagaaccggttcgaacaaaaacggcaaaaaaaaaaaaaggggagcagcaacctttttccaattttgcgtgaagcag  23235500
           ----------->GT1                                            ===============HOX2a_HOX2a
           <----------ID1                                           <---------TOE1(2)
          ----------->GT1                                       <---------KAN1<------ZmHOX2a(2)
          ------------------------>ANAC81                      <-----------ARR10
        ---------->DOF2                                        --------->GLK1(2)
        --------->DOF5.7(1)                                    <---------GATA12                    <
       --------->DOF5.7(1)                                     --------->RVE1(2)                ----
  ----------->GT1                                             <---------GLK1(2)  ------>ZmHOX2a(1) <
--------->ZAT14                                           --------->LBD16    <---------RVE1(2)  <---
<---------ZAT14   --------->DOF5.7(1)                    --------->ANAC46    <---------ARR11(2)<----
---->ZAT2--------->DOF5.7(1)                            <---------LBD16--------->ARR14(2)      <----
-----At4g35610    --------->DAG2                      --------->ARR11(2)--------->GLK1(1)      <----
---->At4g35610   ---------->DOF2                     --------->CCA1(2)<------ZmHOX2a(1)        <----
----->RAV1(1)    --------->DOF5.7(1)--------->YAB5   --------->KAN1<---------LBD16           <------
cagtgaagaaaaaaaggaaaaaaagtgagtgagagaagaagattagaaacgacgatatatacggagaatctcaggatttcgatcctgtttttgttttttc  23235600
---------DAG2                 <---------YAB1                                  <---------LBD16-------
----------->AGL15             --------->ICU4                             --------->KAN4(2)  --------
----------DOF2      <---------DEAR3(1)                                  ------>ZmHOX2a(2)   <-------
------------AGL15  --------->ATERF1(1)  <---------ANAC58               <------ZmHOX2a(2)    --------
-------------AGL3  <------NtERF2        <---------ANAC58              --------->GATA12      ------>NtERF2
-------------AGL1 ------>NtERF2<---------ICU4                         <---------ARR11(3)    <------NtERF2
-------------AG  <---------DEAR3(1)    <---------At4g35610            --------->ARR11(3)   <--------
-------------AGL2--------->ETT(2)     <---------RVE1(2)             --------->DOF5.7(1)    ---------
-----GT1    <---------AtLEC2  <---------YAB5  ---------->DOF2--------------------->WRI1  <---------LBD16
tacttttggtactctccatggcgacggagcgtcatcattttgagcttgctaaaggcatcaatggccttgataagatcgttctccgcgagtctcgcggccg  23235700
     ----------->GT1    <------NtERF2
<---------At4g35610    ------>NtERF2
--------->At4g35610   --------->DEAR3(1)
<---------ZAT14       <---------DEAR3(1)
--------->ZAT14       <---------ANAC46
----->ARR14(2)       --------->ATERF1(1)
------ARR14(2)       <------NtERF2
--NtERF2             ------>NtERF2
-----RAP2.6(3)       --------->RAP2.3(1)
--->RAP2.6(2)       <---------ATERF1(1)
-->SPL7(1)         <---------DEAR3(1)                    --------->GATA12
--DREB2C(1)       <---------LBD16                  <---------GATA12
---DEAR3(1)      --------->ANAC46                  --------->GATA12       <------ZmHOX2a(2)
-----At4g35610   --------->O2                 ------>ZmHOX2a(2)          <---------GATA12
---->At4g35610   <---------O2                --------->At4g35610   <---------WOX13(1)
-->ATERF1(1)    <---------LBD16             <---------GATA12      <---------RVE1(2)              ---
->DREB2C(1)    <-----------GT1              <---------AGP1<------ZmHOX2a(2)                    <----
--ATERF1(1)<---------AHL12(1)      --------->ZAT6  <---------RVE1(2)     --------->GATA12 --------->YAB1
->ATERF1(1)--------->AHL12(1) <----------DOF2<---------At4g35610 --------->ATHB12         --------->YAB5
-ATERF1(1)<---------AHL12(2)--------->ZAT18 <---------RVE1(2)   <---------YAB1            --------->ATHB12
>DEAR3(1) --------->AHL12(2)<---------ZAT18 --------->GATA12    <---------AHL20(2)       <---------YAB1
ctctgcagaggtaaattttcacgcggcgtcgtgctctatctctagttgatctgagatttagatcaatttgattggagatcgatttttgtagtatgattac  23235800
                ------>ZmHOX2a(2)                                                      --------->GATA12
               <------ZmHOX2a(2)                                                       <---------ARR14(2)
              --------->ARR11(2)                                                       <-----------ARR10
              <---------ARR14(2)                                                       --------->ARR14(2)
              <---------GATA12                                                         <---------RVE1(2)
              --------->AGP1                                                           --------->RVE1(2)
              --------->GATA12                                                         <---------AGP1
              --------->ARR14(2)                                                       <---------ARR11(3)
              <---------RVE1(2)                                                       <---------ARR14(1)
              <---------ARR11(3)                                                      <---------CCA1(2)
     <---------ARR14(2)                                                              --------->LBD16
     <---------GATA12                                                             --------->MYB52(1)
     --------->ARR14(2)                                                          --------->ARR14(2)
     --------->GATA12                                                            <---------ARR11(2)
     --------->RVE1(2)                                                           --------->ARR11(2)
    <---------CCA1(2)        --------->ZAT6                                      <---------ARR14(2)
------>GATA12 --------->ARR11(3)     <---------YAB1                       <---------WOX13(2)<-------
-----YAB1     <---------ARR11(2)   <---------ZAT6                    <---------ZAT6<---------LBD16<-
gatttgcaaatctcttagatccttgggttttagctctagtgttattgagttctgtatttgtttatgcaatttgtgttaatggaagaaccggatctgcgtg  23235900
<- Previous    Next ->

AGI:  At5g57330.1   
Description:  aldose 1-epimerase family protein. similar to aldose 1-epimerase family protein [Arabidopsis thaliana] (TAIR:AT3G61610.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO43213.1); contains InterPro domain Aldose 1-epimerase; (InterPro:IPR008183); contains InterPro domain Glycoside hydrolase-type carbohydrate-binding; (InterPro:IPR011013); contains InterPro domain Glycoside hydrolase-type carbohydrate-binding, subgroup; (InterPro:IPR014718)
Range:  from: 23235440    to: 23238315    Orientation: Forward
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version