AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                               ------->TEIL
                                            <---------ATHB12
                                    <---------ARR14(2)
                                    --------->ARR11(2)
                                    --------->RVE1(2)
                                    --------->ARR11(3)
                                    <---------ARR11(3)
                                    --------->ARR14(2)
                                   --------->RVE1(1)                                          ------
                                   --------->CCA1(1)                                    <--------ATHB1
                                  <---------AHL25(2)                                    --------->YAB1
                                  --------->AHL25(2)                                    --------->ATHB12
                                 <---------AHL12(2)                                     --------->YAB5
      <---------AHL12(1)         --------->AHL12(3)                                     <---------ICU4
      ---------->DOF2            --------->AHL12(2)                                    --------->ICU4
      <---------AHL20(2)       --------->AHL12(3)                                      <---------YAB1
      --------->AHL20(2)       <---------AHL20(3)         <---------AHL12(2)      --------->TOE2(3)
     <---------ATHB12          --------->AHL20(3)         --------->AHL12(2)      --------->RVE1(2)
---------At4g35610             <---------AHL12(3)        --------->AHL20(2)      <---------KAN1
-------->At4g35610             --------->AHL20(2)       <---------YAB1          --------->RVE1(2)
--->WOX13(2)                   --------->AHL25(1)     --------->YAB1            --------->GLK1(2)
----WOX13(2)            --------->LBD16 <---------------------WRI1             <---------GLK1(2)<---
-->YAB5          ---------->DOF2 <---------AHL12(3)   --------->YAB5  <---------ANAC58 <---------YAB5
-MYB52(1)     ----------->GT1  --------->AHL25(2)    <---------ATHB12 <---------ANAC58 <---------ATHB12
 
taagctcaataaatcaccagtaaaacccccaaaaaaaaatatctgcaatgaactcaatgataatatacaaattgccttctaagaatctcaatgattagat  23082200
                                                      --------->TOE2(3)                         <---
                                                     ------>ZmHOX2a(2)                     <--------
                                                   <---------RVE1(2)                      ----------
                                                <---------WOX13(1)                     --------->TOE2(3)
                                              --------->ATHB12                        <---------ICU4
                                             <---------AHL20(2)                       --------->ATHB12
                                             <---------YAB1                           <--------HAHB4
                                         --------->AHL20(2)                           --------->YAB5
                                         <--------ATHB1                              <---------YAB1
                                         --------->AHL25(2)                          <---------YAB5
                                         <---------AHL20(2)                          --------->ICU4
                                         <---------AHL25(2)                        <---------ICU4
                                         --------->ATHB51                          --------->YAB1
                                         <---------AHL25(3)                    --------->AHL12(1)
                                         <---------ICU4------>ZmHOX2a(1)       <---------AHL20(2)
                    --------->WOX13(1)   <---------AHL12(1)                    --------->AHL20(2)
                  <---------ATHB12       --------->AHL12(1)                    <---------AHL25(3)
                 ------>MYB83           <---------ATHB51           ----------->GT1<---------ATHB12
 --------->KAN1  ------>MYB46(1)        <---------ATHB12  <---------WOX13(2)   <---------AHL12(1)---
--->GATA12      --------->WOX13(1)      --------->ICU4--------->TOE1(3)       <---------ATHB12 <----
----TEIL   ---------->DOF2              --------->AHL25(3)--------->WOX13(2)  <---------KAN1 -------
 
tcatacattcaccataaaccaatcaatcgcagaagagaaaacaataatttgattgatccttaaataacttcagtaaaactaataaatcatcattaaaccc  23082300
           <---------ARR11(3)
           --------->ARR11(3)
          --------->RVE1(1)
         --------->AHL12(1)
         <---------AHL12(1)
        <---------AHL12(2)                                                 <---------KAN1
        --------->AHL20(3)                                  --------->AHL12(1)
        <---------AHL20(3)                                  <---------AHL12(1)
   ----------->GT1                                         <---------AHL20(3)                     --
  >>>>>>>>>TBF1                                            --------->AHL20(3)                    ---
--------RAV1(2)         --------->YAB1                     --------->AHL25(1)                    <--
---GT1  --------->AHL12(2)                            ----------->GT1    <------ZmHOX2a(1)     -----
>DOF2 >>>>>>>>>>GT-3b --------->RVE1(2)      --------->AHL20(2)    <---------GATA12           <-----
------>LBD16   --------->At4g35610         <---------WOX13(2)      --------->GATA12          <------
-----LBD16--------->CCA1(1)            --------->RVE1(2)   <---------AHL25(1)     --------->ARR14(2)
-->ANAC46--------->AHL25(2)  <---------KAN1--------->WOX13(2) --------->RVE1(2)   <---------ARR14(2)
 
cagaagaagaaaaatatcatctcaaaatcagaataaacacaaaatcaatttaagaacgagaaaaaaatcaaatcgaggatgagagaattcgatggaatta  23082400
              --------->At4g35610
              --------->ZAT14
 --------->GLK1(2)
<---------GLK1(2)       <---------At4g35610
------->ANAC46<---------ZAT14
------>HSFB2a(2)     <---------YAB5             <---------KAN1
-------HSFB2a(2)    <-----------TGA1<----------DOF2    --------->ARR14(2)
---->MYB52(1) <---------At4g35610  <---------ANAC58    <---------ARR14(2)              <---------AHL20(2)
------GT1----------->HVH21         <---------ANAC58   --------->KAN1     <---------RVE1(2)        --
---KAN1--------->REM1(2)--------->At4g35610    <---------KAN4(2)  <---------KAN1      <----------DOF2
 
ccagaaactgtgttgacagcagtcgtcatcttcgtcttgctttagacgagaatgagcaaattcgatggaatttagggattttgtaggggttttattgtga  23082500
                                              --------->YAB5
                                             <---------YAB5
                                           <---------AtLEC2
                                           <---------ANAC58
                                      <---------ICU4
                                     <---------YAB1
                                    --------->AHL20(1)
                                    --------->AHL20(3)
                                    <---------AHL25(2)
                                    <---------AHL20(3)
                                    --------->AHL12(2)
                                    --------->AHL25(2)
                                    <---------AHL12(3)
                                    <---------AHL12(2)
                                    <---------AHL20(1)
                                    --------->AHL20(2)
                                    <---------AHL20(2)
                                    --------->AHL12(3)
                                   --------->YAB1
                                   <---------AHL25(3)
                    <---------MYB52(1)--------->ATHB51
               --------->GLK1(2) <---------AHL12(3)
               <---------ARR14(2)<---------AHL25(2)
               --------->ARR14(2)<---------AHL12(2)     --------->ANAC58
              --------->KAN1     <---------AHL20(3)     --------->ANAC58
             --------->DOF5.7(1) --------->AHL25(2)     --------->ANAC46     ------>ZmHOX2a(1)
        ----------->GT1          --------->AHL20(3) --------->ANAC46        <---------MYB59
<-----------------AGL1         --------->ICU4<---------YAB1                *TSS       <---------YAB5
<-----------------AGL2    ----------->GT1  <---------ANAC58 ----------->RAV1(1)--------->WOX13(2)
------->GLK1(2)--------->RVE1(2)<---------ICU4--------->ATHB12<---------ALFIN1 <---------WOX13(2)
 
gagtctgaatttgggaaaaatccgttgagaggtaaaaattataattgcatgattcccacaaggcaacactggaattggtcctaatttgaaacatcgccag  23082600
                                                                                                ----
                                                                                           <--------
                                                                                          <---------DOF5.7(2)
                                                                                        --------->DOF5.7(2)
                     <---------ALFIN1                                                  --------->TOE2(3)
                  <---------TCP20                                                      --------->TOE1(3)
                  --------->PCF2                                                      --------->O2
                  <---------TCP15(1)                                                  --------->ANAC58
                 <---------PCF2                                                       --------->ANAC58
                <---------ANAC58                                      <----------DOF2 --------->bZIP60(2)
                <---------ANAC58                            ------>ZmHOX2a(1)        ------>NtERF2
            <------------CBF                          <---------AHL20(2)         --------->ANAC58
          <---------YAB1            --------->KAN1   <---------AHL25(1)          --------->ANAC46
      --------->TOE2(3) <---------DOF5.7(1)<---------WOX13(2)    <----------DOF2 --------->ANAC58<--
     --------->At4g35610<---------DAG2<---------YAB1 --------->AHL20(2)          --------->RAP2.6(2)
     <---------At4g35610<----------DOF2    --------->WOX13(2)   <---------DOF5.7(1) <---------ALFIN1
 
actgttttagcttaatattgggtcccacttttatatgttttatgctaattaagtcattaaatccttctcttttctttgtttagaccgccacgttaactat  23082700
                                                    <---------YAB1
                                               --------->YAB1
                                              <---------YAB5
                   <---------YAB1           --------->YAB1
                  --------->AHL20(3)       --------->ICU4                                        ---
                  <---------AHL20(3)       <---------YAB1                                       <---
                  --------->AHL20(1)   --------->TOE2(3)                                   ---------
      <---------PCF2                  --------->ANAC55(2)                                <---------LBD16
<---------YAB1    <---------AHL12(2)  <---------ANAC55(2)    --------->AHL12(2)       --------->KAN1
----->AHL20(2)    <---------AHL25(2) <---------TOE2(2)    ---------->ID1         --------->TOE1(3)
-WOX13(2)<---------DOF5.7(1)      <---------DOF5.7(1)<---------DOF5.7(1)         --------->TOE2(3)
-------AHL20(2)   --------->AHL25(2) <---------TOE1(2)<----------DOF2            <----------DOF2----
 
tttataatgggcccttacaaatattatggcccatgggtcttacgttataatggtcatctttgttttttttttggttcagtctaactttaacatgcggaga  23082800
                                                                                                  --
                                                                                                 <--
                                                                                             -------
                                                                                             <------
                                                                                             <------
                                                                                             -------
                                                                                             <------
                                                                                            <-------
                                                                                            --------
                                                                                           <--------
                                                                                           ---------
                                                                                           ---------
                                                                                           <--------
                                                                                           <--------
                                                                                           <--------
                                                                                           ---------
                                                                                          --------->AHL20(2)
                                                                                          <---------AHL20(2)
                                                                                          --------->AHL20(3)
                                                                                          <---------AHL20(1)
                                                                                          --------->AHL12(1)
                                                                                          <---------ARR11(3)
                                                                                          --------->AHL20(1)
                                                                                          <---------AHL20(3)
                                                                                          <---------AHL25(3)
                                                                                          --------->ARR11(3)
                                                                                          --------->AHL25(1)
                                                                                          <---------AHL12(1)
                                                                                          <---------AHL25(1)
                                                                                          --------->AHL25(3)
                                                                                          --------->AHL25(2)
                                                                                          <---------AHL25(2)
                                                                                         --------->AHL12(2)
                                                                                         <---------AHL12(2)
                                                                                         <---------AHL12(1)
                                                                                         --------->AHL20(2)
                                                                                         --------->AHL12(1)
                                                                                         <---------AHL12(3)
                                                                                         --------->AHL12(3)
                                                                                     --------->AHL20(2)
                                                                                     <---------AHL20(2)
                                                                                     --------->AHL25(3)
          <---------GLK1(2)                                                          --------->AHL25(2)
          --------->ARR11(3)                <------ZmHOX2a(2)                        <---------AHL25(2)
          <---------RVE1(2)                <---------ARR11(2)                        <---------AHL25(1)
          <---------ARR11(3)               --------->GATA12                          --------->AHL25(1)
------>ZAT6                                --------->ARR11(2)                        --------->AHL20(3)
------ZAT14                                <---------GATA12 --------->At4g35610      <---------AHL20(3)
>LBD16  ----------->ARR10     <----------DOF2               <---------At4g35610  --------->YAB5 ----
----->ZAT18    <-----------GT1<---------DOF5.7(1) --------->YAB1       <----------DOF2 <---------AHL12(2)
 
acactattggatagatttttactcaagagtcgacttttatgaaatcgatccattcatattttgagttgccatttctttcttatatgaataaaatatattt  23082900
       ----------->GT1
 --------->YAB5
 <---------ICU4
------->YAB1
-------AHL20(2)               --------->YAB1
-->AHL12(3)                  <---------ATHB12                                      --------->ANAC58
---AHL12(3)              --------->AHL12(3)                                        --------->ANAC58
---AHL20(3)              <---------AHL20(3)                                        --------->ANAC46
-->AHL20(3)              <---------AHL12(2)                                        --------->O2
---AHL20(2)              <---------AHL12(3)                                      <---------ALFIN1
--AHL12(2)               --------->AHL20(3)                                     <-------TEIL
->AHL12(2)               <---------AHL25(1)           <-----------GT1          --------->CCA1(2)
-AHL12(2)               --------->YAB1         <---------AHL25(2)             <---------ARR11(2)
>AHL12(3)               <---------AHL25(3)     <---------AHL20(3)             --------->ARR14(2)
>AHL12(2)              --------->AHL20(2)      <---------AHL25(1)             <---------RVE1(2)
-AHL20(2)        ----------->GT1<---------YAB1 <---------AHL20(2)             <---------ARR14(2)
-AHL12(3)   --------->YAB1   --------->ICU4    --------->AHL12(3)             --------->ARR11(2)
-AHL12(1)   <---------AHL12(2)--------->YAB5   <---------AHL12(3)        --------->CCA1(2)
>AHL12(1)   --------->AHL12(2)<---------ICU4   --------->AHL20(3)--------->TOE2(3) <---------O2
----->AHL20(2) --------->MYB52(1)        ----------->GT1--------->ANAC46<---------RVE1(2)     ------
 
ttaataactatggaaaaataacgaaaataaaaatcattatagaatagtattttttttatacaaaactacataaatgatatggatacacgtctagcaaaat  23083000
             <-----------GT1
             --------->ZAT6
        <---------AHL12(2)
       <---------AHL12(1)
       <---------AHL20(3)
       <---------AHL25(1)
       --------->AHL20(2)
       --------->AHL20(3)
       <---------AHL25(3)
       <---------AHL12(3)
       --------->AHL12(1)
       --------->AHL25(1)
       --------->AHL12(3)
       <---------AHL20(2)                 <---------ANAC58
      --------->AHL25(3)          --------->ANAC58
      <---------AHL20(2)          --------->ANAC58
     --------->AHL12(2)           --------->ANAC46
     <---------AHL12(2)   <---------TOE2(3)
  <---------MYB52(1)     ---------->DOF2  <---------ANAC46
 <-------GAMYB        <----------DOF2     <---------ANAC58    <---------ZAT18                -------
----------->GT1      --------->TOE2(3) <---------CCA1(2)--------->MYB52(1)                 ---------
---->DOF2  <-----------GT1<---------TOE1(3)       ----------->HVH21                        ---------
 
agcccgttatttatttacactcttcctttaaagttgcaagtcatatcgtgtctctgacttatcggtgcaattttagacaatacagtttcaaactttgacc  23083100
<- Previous    Next ->

AGI:  At5g57000.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G72690.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO65331.1)
Range:  from: 23080978    to: 23082576    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version