AthaMap TU-Logo
Exon region
Intron region
UTR region
% Restriction to highly conserved TF binding sites (0-100)
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
              <---------GLK1(2)                                                    --------->RAP2.6(3)
            --------->LBD16                                                       <---------DOF5.7(2)
            <---------TOE1(2)                                                     --------->MYB52(1)
           <-----------RAV1(2)                                                   <---------WRKY12  -
         <XXXXXXXXXXXXXXXXXXXXXXXMIR163                                          <---------WRKY38(1)
     --------->DAG2                                                           --------->LBD16      -
    ---------->DOF2                                   <---------ANAC46  <---------YAB5             <
----------AGL15                                       <---------bZIP60(2)--------->KAN1           --
--------->AGL15                     --------->DOF5.7(1)    ---------->DOF2  <---------LBD16    -----
---------->AGL2      <<<<<<<<<TBF1---------->DOF2  ----------->HVH21    <---------ATHB12     <------
aaatgagaaaagttccaggttttcttcttcgtagagagaaagagattgagaaatgtgacctgtaaaccgcttgaaatcatccggttaacggcattgttac  22439500
     --------->DEAR4(1)          --------->GLK1(2)
     --------->At1g77200        <---------GATA12
    --------->DEAR3(2)          --------->ARR14(2)
  --------->DEAR3(1)            <---------ARR14(2)
  --------->AtMYB61             <---------ARR11(2)
  <---------ALFIN1              --------->GATA12
 <---------MYB55(2)            --------->HSFB2a(1)
 --------->MYB46(3)            --------->KAN1
-------->DEAR3(1)             <---------TOE1(2)
-------->AtMYB61  --------->TOE1(3)
---------ALFIN1   <---------DOF5.7(1)
------->MYB46(3)  --------->TOE2(3)                                                      <----------DOF2
---->MYB46(3)------>MYB83     <---------TOE2(2)        --------->TOE2(3)  <---------RVE1(2)
-----GT1 ------>NtERF2--------->WOX13(2)            <---------ALFIN1      --------->ARR11(3)
caccaccaccgacaccaatcaccttaattctcgcagattccatcggagagaaggaacacctcaatcgcatcgacttagaccttgttgaatcgcttcttcg  22439600
        <-----------HVH21                                                              --------->MYB52(1)
       --------->ANAC46                                                             --------->ANAC58
       --------->RAP2.3(3)          <---------LBD16                                 --------->ANAC58
       --------->ANAC58--------->YAB5 --------->LBD16                       <---------RVE1(2)
       --------->RAP2.3(2)     <<<<<<<ZML2                              <-----------------AG
       --------->RAP2.6(2)     <---------ARR11(3)                      --------->GLK1(1)
       --------->ANAC58--------->KAN1<---------ANAC46                  --------->CCA1(2)
       --------->DEAR3(1)      --------->ARR11(3)                     --------->ARR11(3)
       <---------ATERF1(2)  --------->HSFC1(1)                  --------->YAB1  ----------->GT1
      --------->ERF1 <---------WOX13(1)                    --------->MYB46(3)   <------MYB83
      --------->RAP2.3(1)   --------->HSFB2a(2)--------->At4g35610    <---------ARR14(2)
      --------->ATERF1(1)   <---------HSFC1(1) <---------At4g35610    <---------ARR11(3)
     --------->At4g35610    <---------HSFB2a(2)<---------ZAT2  <---------KAN1   <------MYB46(1)
     <---------ATERF1(1)<---------GLK1(2)     ------->TEIL <---------MYB52(2)  --------->MYB59>>>>>>
tttagagaagccgccacggaattgactgattctagaacttgcgcaaatgcagctactatgcaacgaatgagaagatatcgatttggtaagaaacgaagaa  22439700
                        <---------At4g35610 >>>>>>>>>>>>>>>>>LFY
                   <---------WOX13(2)  <---------YAB5
                   --------->WOX13(2)  <---------KAN1
               <---------At4g35610     --------->ICU4
               --------->At4g35610 ------->GAMYB                 <----------DOF2      ---------->DOF2
            --------->DOF5.7(2)   --------->ANAC58          <---------At4g35610   <----------ID1
            <---------MYB52(1)    --------->ANAC58          ------>ZmHOX2a(1) --------->DOF5.7(1)
>>>TBF1    --------->TOE2(3)    --------->MYB52(1)   <-----------GT1        ---------->DOF2---------
gaagatgaagaaatcgttagctcattaagctgtgctaacggaattatcgccattgtttacttcctctgctttcagagaagaaagagagacaaagagatgg  22439800
                                                                           ----------->GT1 ---------
                                                                          *TSS             <--------
                                                                          --------->DAG2  --------->ALFIN1
                                                                        ---------->DOF2 <---------ANAC46
                                                                   ---------->DOF2   <------ZmHOX2a(2)
              <---------TOE2(3)                               <---------------AGL15 <---------GATA12
    <---------TOE1(3)     --------->ETT(2)      --------->ZAT14------>ZmHOX2a(1)    --------->GATA12
    <---------TOE2(3)     <---------ETT(2)      <---------ZAT14=============================HOX2a_HOX2a
>CCA1(2)      <---------TOE1(3)        --------->RVE1(2)   <-----------GT1--------->DOF5.7(1)<------
gttttttagggttttttagggttttagtgtcgacgaagaaaatatcaacagttcagagtttttttcctcacaaaggaaaggtgaagagatcgagtggacc  22439900
     ----------->RAV1(2)                                             <----------DOF2  --------->AHL20(2)
-->ARR14(2)                                                  <---------AHL20(3)       <---------AHL20(2)
-->TCP16(1)                                                  --------->AHL20(3)       --------->AHL20(3)
-->PCF5                 ------>NtERF2                       <---------ICU4           <---------AHL20(2)
-->PCF2                --------->DEAR3(1)                --------->YAB1              --------->AHL25(3)
>WRKY12              --------->YAB5         --------->ARR11(2)   <---------YAB1      --------->AHL20(2)
>ZAT18            --------->MYB52(1)        --------->ARR14(2) --------->YAB1      <---------WOX13(2)
>WRKY38(1)    --------->ANAC58              <---------ARR11(2) <---------ICU4      --------->WOX13(2)
-ZAT18    <-----------HVH21                 <---------ARR14(2)--------->ICU4   <----------DOF2
---ARR14(2)   --------->ANAC58    <------------CBF     --------->RVE1(2)  ---------->DOF2  <--------
ctctaaacctctgggtcacacaaacgacgacgtttcacattgatgcagaaccgttcagaatcaaaattatgactttgaaaagcttttattaaattaacaa  22440000
         <---------KAN1             --------->GATA12
         <---------ZAT6            <---------GLK1(1)
       <---------ANAC58            --------->GLK1(1)
 <-----------RAV1(1)  --------->TOE2(3)  --------->ZAT2                                           --
-->ZAT6<---------ANAC46     --------->DAG2 <----------DOF2          ----------->GT1             ----
--TOE2(3)--------->ALFIN1   --------->DOF5.7(1)                 --------->YAB1               -------
---GT1 <---------ANAC58   ---------->DOF2<---------ZAT2    <---------KAN1         --------->AHL12(1)
tacattgttggagtgtttggagtaatctcaaaagggagagatccagctttgttttttgaagaatgaatgagaagtgatttcaagaaaatttgaaaatagt  22440100
                                                                              <-------TEIL <--------
                               --------->ANAC58                             <---------ARR14(2)
         ----------->GT1       --------->ANAC46                             --------->ARR11(2)
        --------->DAG2         --------->ANAC58                             <---------ARR11(2)
      ---------->DOF2<---------MYB46(3)              --------->ANAC58       --------->ARR14(2)
 <----------ID1   --------->GATA12                   --------->ANAC58       --------->ARR11(3)
------->DOF5.7(1) <---------GATA12        <---------------AtSPL8    --------->ATHB12 --------->ATHB12
------>DOF2       <---------RVE1(2)   --------->CCA1(2)     ----------->GT1 <---------ARR11(3) <----
---->GT1--------->DOF5.7(1)  <---------ALFIN1    --------->ANAC46  <---------YAB5  --------->ANAC58
aaagaggccaaaaggtttttagatttgttgacacactcaagataagagttacaaacaagaaaactgtttaaagattgaagatacacaaggattggatttt  22440200
                   <---------DOF5.7(1)                                                        <-----
                  <----------DOF2      <---------ANAC58                                       ------
                  <---------DAG2       <---------ANAC58                                       <-----
           <---------ANAC46        <---------MYB46(3)   <---------GATA12                      ------
       <----------DOF2            <--------P            --------->GLK1(2)                    <------ZmHOX2a(1)
-RVE1(2)   <---------ANAC58    <---------TOE2(3)      <------ZmHOX2a(1)                 --------->YAB1
-------GT1 <---------ANAC58    <---------TOE1(3)--------->REM1(2)                    --------->WOX13(1)
actcgactgactttgcgcatgctttttctagtttgaggttgttcttgtctgagtagaggaatctactctgtttcgcttagaatggggacaatcagaggat  22440300
                           ------>MYB83                        --------->SPL7(1)
         <---------AHL20(1)-------->P                        --------->TOE2(2)
    --------->ZAT14       --------->MYB55(1)        ----------->GT1
    <---------ZAT18      --------->AtMYB61         --------->DAG2
---------At4g35610       <---------MYB46(2)        --------->DOF5.7(1) --------->ANAC58
-------->At4g35610       <---------MYB55(2)        <---------------AtSPL8
----TEIL <---------ARR11(3)------>MYB46(1)        --------->DOF5.7(1)  --------->ANAC46
------YAB5               --------->MYB46(3)--------->AHL20(2)--------->TOE1(2)    --------->RVE1(2)
----ARR11(2)             <---------MYB111(1)     ---------->DOF2       --------->ANAC58
--->ARR11(2)             <---------MYB111(2)     --------->DOF5.7(1) ---------->DOF2
----ARR14(2)             <------------AtMYB15   --------->DOF5.7(1) --------->AtMYB61              -
--->ARR14(2)          <---------ALFIN1  ----------->GT1     <---------KAN1----------->RAV1(1)      <
tcatctgtgcaatatatacaattgcccacctaccatagtcaagagattaaaaaaaaggtaagaacatacgaccaaagcaacatagtatcaaactcgatat  22440400
<- Previous    Next ->

AGI:  At5g55280.1   
Description:  FTSZ1-1 (FtsZ1-1); structural molecule. Identical to Cell division protein ftsZ homolog, chloroplast precursor (FTSZ) [Arabidopsis Thaliana] (GB:Q42545;GB:Q9FLN6); similar to FTSZ2-2 (FtsZ2-2), structural molecule [Arabidopsis thaliana] (TAIR:AT3G52750.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO38883.1); contains InterPro domain Cell division protein FtsZ; (InterPro:IPR000158); contains InterPro domain Tubulin/FtsZ, GTPase; (InterPro:IPR003008); contains InterPro domain Tubulin/FtsZ, C-terminal; (InterPro:IPR008280)
Range:  from: 22437878    to: 22439875    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
AGI:  At5g55290.1   
Description:  ATP synthase subunit H family protein. similar to ATP synthase subunit H family protein [Arabidopsis thaliana] (TAIR:AT4G26710.2); similar to ATP synthase subunit H family protein [Arabidopsis thaliana] (TAIR:AT4G26710.1); similar to unknown [Populus trichocarpa] (GB:ABK92781.1); contains InterPro domain ATPase, V0 complex, subunit E; (InterPro:IPR008389)
Range:  from: 22440263    to: 22441312    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version