AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
    <---------ALFIN1                                              <---------AHL25(1)
    --------->ANAC58                                              <---------AHL12(1)
    --------->ANAC58                                              --------->AHL12(1)
    --------->ANAC46                                             <---------AHL20(3)
  <---------ALFIN1                                        --------->ANAC46
------>KAN1                                               --------->ANAC58
-------GT1                                      --------->GLK1(2)--------->AHL20(3)
-->AHL20(2)                                     --------->RVE1(2)--------->AHL12(2)
-->YAB1                                        <---------GLK1(2) --------->AHL25(2)
--YAB1                                       --------->LBD16     <---------AHL25(2)
--YAB5                                      --------->HSFB2a(2)  <---------AHL12(2)         --------
-AHL20(3)                                   <---------HSFB2a(2) --------->YAB1   --------->WOX13(1)
>AHL20(3)                           ------->TEIL<---------GATA12--------->AHL12(2)  --------->YAB1
>WOX13(2)              <---------CCA1(2)   <---------LBD16--------->ANAC58     <---------KAN1  <----
-WOX13(2)       <------ZmHOX2a(1)   <-----------GT1      XXXXXXXXXXXXXXXXXXXX>MIR2939    --------->RVE1(2)
 
acatcccacaccatcttcaggactccatctctccctatgtaacttctccagaatctaaaacacacaaaaataatccattagcatctatcaaaaatcaaag  22318500
                      --------->ANAC46
                    <---------ALFIN1                      --------->LBD16
         ---------->DOF2                                <---------LBD16
      --------->CCA1(2)                             <----------DOF2  --------->ANAC58          <----
     <---------ARR11(3)       <-----------GT1       <---------DAG2   --------->ANAC58          >>>>>
-->DOF2<-------TEIL --------->ANAC46        --------->RVE1(2)      ---------->DOF2          --------
-----At4g35610  <---------ALFIN1          --------->DOF5.7(1) <---------KAN1    <-----------GT1-----
 
ctgatcaagatacaaagctacacacacagcaataaactctatcgaaaaatcgaaactttaccggaataacaaaagccagagttttgccagacccagttct  22318600
                     --------->ANAC46
                   <---------------AGL15
                  ----------------->AGL2
           --------->ARR11(3)
           <-----------ARR10
           <---------ARR11(3)
           --------->RVE1(2)                                                               <--------
          --------->RVE1(1)                                                                <--------
          <---------KAN1          <------ZmHOX2a(1)                   ------->TEIL        <---------DOF5.7(1)
--------->At4g35610--------------->AGL15                 <-----------HVH21               ------>ZmHOX2a(1)
-----HSFB2a(2)    ==================================================================================
>>ZML2  --------->YAB1  ---------->DOF2                 --------->WOX13(1)      <----------DOF2
->AGP1  <---------GLK1(2)--------->DAG2    <---------ALFIN1--------->YAB1     <---------KAN1  ------
---->HSFB2a(2)    ----------------->AGL3  --------->At4g35610 --------->RVE1(2)<---------DOF5.7(1)
 
agcagcaccaagaatatctcttccacataaagcatgaggaatagcagcactctgaacatcagtcatatcaacgtatttcgcatctttcaatcctcttttc  22318700
                                                                                                 <--
                                                                                                ----
                                                                                              <-----
                                                                                              <-----
                                                                                              ------
                                                                                              ------
                                                                                              ------
                                                                                              ------
                                                                                             <------
                                                                                        ============
                                                                                        ============
                                                                                        ------>ZmHOX2a(2)
                                                                                       --------->KAN1
                                                                                       <------ZmHOX2a(2)
                                                                                       =============
                                                                                       =============
                                                                      ------>NtERF2   <---------GATA12
                                                                    ---------->ID1    --------->ARR11(3)
                                                                  <-----------GT1     <---------RVE1(2)
    --------------->AGL15                                      <---------DOF5.7(1)    <---------ARR11(3)
    <---------------AGL15                                     <---------DOF5.7(1)     --------->GATA12
   <-----------------AGL1                                     <---------MYB52(1)      <---------ARR14(2)
   ----------------->AGL1                                    <---------RAP2.6(3)      <---------ARR11(2)
   ----------------->AG --------->HSFC1(2)                  <---------ANAC58          --------->ARR14(2)
   <-----------------AG <---------HSFC1(2)                  <---------ANAC58          --------->ARR11(2)
--------->KAN1 <---------WOX13(2)  ----------->RAV1(2)      <---------ANAC46    <----------DOF2<----
-DOF5.7(1)    --------->MYB52(1)   --------->At4g35610     <------NtERF2       <---------HSFB2a(1)
--DOF2     --------->ANAC46      <---------ALFIN1         ------>NtERF2  --------------------->WRI1
====================MADS_MADS  <---------ALFIN1           --------->ABI4(2)    --------->HSFB2a(1)
---->ID1   --------->ANAC55(2)------>ZmHOX2a(1)     --------->MYB52(1)<---------RAP2.6(3)    <------
 
gttttatccgatataggtaactgagcaaacttcctcacacctgcataccgagagaaaacggtgccgtttttgccgtcttcggactttccgatcttcgaat  22318800
    --------->DOF5.7(1)
  <------ZmHOX2a(1)
--------DOF2                          <---------LBD16                      <---------AHL25(3)
----->YAB5              >>>>>>>>>GATA-2                                    <---------AHL25(1)
----ARR11(1)            <---------GATA12  --------->ARR14(2)               --------->AHL25(1)
----ARR14(2)            >>>>>>>>>GATA-3   <---------ARR14(2)            --------->ARR11(3)
--->GATA12--------->ANAC58          --------->GATA12      <---------ALFIN1 <---------AHL12(3)
->TEIL  <------ZmHOX2a(1)           --------->ARR11(2)   --------->MYB46(3)<---------AHL20(2)
--->GLK1(2)      ---------->DOF2    <---------GATA12    <------ZmHOX2a(2)  --------->AHL12(3)
--->ARR14(2)    --------->YAB1      <---------ARR14(2) <---------ARR11(2) <---------AHL12(1)
---CCA1(2)--------->ANAC58          <---------ARR11(2) <---------GATA12 <---------ARR11(3)
=========HOX2a_HOX2a    >>>>>>>>>GATA-1  <---------MYB52(1)         <---------At4g35610
===============HOX2a_HOX2a          --------->ARR14(2) --------->GATA12 --------->GATA12
===============HOX2a_HOX2a       ------>ZmHOX2a(1)     --------->ARR11(2) --------->AHL25(3)
=========HOX2a_HOX2a    >>>>>>>>>GATA-4 --------->LBD16--------->ARR14(2) --------->AHL20(2)
-----KAN1 --------->ANAC46   <---------ARR14(2)  --------->KAN1   <-----------RAV1(2)
---ARR14(1)    <---------ATHB12  ==============================HOX2a_HOX2a--------->AHL12(1)
 
ctttaggaagaggacgcaatgaaagtggattgaatcctgaatccggtttctgtgattcgatccactgcttcagaagatttatttcttcgacttcgttgag  22318900
                                                                                <---------At4g35610
                                                                                --------->At4g35610
                                                                             ---------->DOF2
                                                                        --------->CCA1(2)
                                                                       <---------ARR14(2)
                                                                       <---------RVE1(2)
                                                                       <---------ARR11(2)
                                                                       --------->ARR11(2)
           <---------ICU4                                              <---------ARR11(3)
           --------->KAN1                                            --------->LBD16
          ------>ZmHOX2a(1)                                         <---------------AGL15
         --------->TOE2(3)                                          --------------->AGL15
    --------->At4g35610                                            <-----------------AG
 <---------KAN1                                                    ----------------->AGL1
<---------GATA12                                                   <-----------------AGL1
------->TEIL                                                       <-----------------AGL3
--------->GLK1(2)                        <---------ICU4            ----------------->AGL3
<-----------ARR10                  <-----------GT1                 ----------------->AGL2
--------->ARR14(2)              <---------ICU4                  --------->At4g35610
<---------ARR14(2)            --------->AHL12(2)      --------->ANAC58 --------->ARR11(3)
<---------ARR11(2)            --------->WOX13(2)      --------->ANAC46 --------->ARR11(1)
--------->ARR11(2)            <---------WOX13(2)      --------->ANAC58 --------->ARR14(2)
--------->GATA12  <---------MYB52(1)<---------At5g28300         <---------At4g35610
 
acgaatctgcttcctcattcccttagtcttcttaatttttaccatcttgacacaaacacgaagttagagctccagatatggaaagcttacgacttgagag  22319000
                                                 <-------TEIL
                                                --------->CCA1(2)
                                               --------->ARR11(2)
                                            <---------WOX13(1)            --------->WOX13(2)
                                       --------->CCA1(2)                  <---------WOX13(2)
                                      --------->GATA12                    <------------CBF     -----
              --------->At4g35610     <---------RVE1(2)                ------------>CBF        -----
           --------->DOF5.7(1)        <---------GATA12         <---------REM1(1)           <--------
           ---------->DOF2          <---------TOE1(3)      --------->ARR11(3)            --------->YAB5
         ---------->DOF2    <---------TOE1(3)  <---------ARR11(2)  --------->At4g35610 <---------TOE1(3)
   <---------KAN1           <---------TOE2(3)  <---------RVE1(2)   <---------At4g35610 <---------TOE2(3)
 <---------GLK1(2)   ---------->DOF2<---------TOE2(3)      <---------ARR11(3)    ----------->GT1  <-
 
gctagaatttgcaaaagagcagacaaaagttagggttttaagatttgatagatacacaagaagatgttgaagcagccaattgaagggtttaacgatgagt  22319100
                                                     --------->DOF5.7(1)
                                                   ---------->DOF2
                                               <-------TEIL
                                              --------->CCA1(2)
                                             <---------ARR14(2)
                                             <---------ARR11(2)
                                             --------->ARR11(2)
                 <---------------AGL15       --------->ARR14(2)
                 --------------->AGL15      <------ZmHOX2a(1)            <---------AHL25(2)
              <-----------GT1             <---------TOE2(3)              <---------AHL20(2)
          --------->AHL20(2)             --------->YAB1                  --------->AHL25(1)
          <---------AHL20(2)            <---------ATHB12                 --------->AHL25(2)
    <----------DOF2                 ------------>CBF---------->DOF2     <---------DOF5.7(1)
------>TGA1 --------->WOX13(2)     ----------------->AGL1        ---------->DOF2
------>HVH21<---------WOX13(2)     <-----------------AG      <---------ATHB12   ---------->ID1
-YAB1<---------DOF5.7(1)           <-----------------AGL1------------>CBF--------->AHL12(3)
--------bZIP60(2)====================================MADS_MADS--------->YAB1   <-----------GT1<-----
 
gacgatgctttttttaattaccaaaaaaactaatctaggcccaataaggatacacaaaggcccaataacaaagcattttttttttcgcttccctcgtcta  22319200
                <---------GLK1(2)
                <---------RVE1(2)
              <---------YAB1
        ------>ZmHOX2a(2)                                                               <---------ZAT14
       <---------GLK1(1)                                                                --------->ZAT14
       --------->GLK1(1)                                                                --------->ZAT18
      <---------ARR14(2)                                                               <---------KAN1
      --------->ARR14(2)                                                           <---------ANAC46
      <---------ARR11(3)                                                           <---------ANAC58
      <---------AGP1--------->HSFB2a(2)                                            <---------ANAC58
      <---------GATA12                                                   <---------AHL20(2)
      --------->GATA12    *TSS                                           <---------AHL12(3)
      --------->ARR11(3)--------->ARR11(2)                               --------->AHL20(2)
      --------->ARR11(2)--------->ARR14(2)                 --------->TOE1(2)    <---------GATA12 ---
      <---------ARR11(2)<---------ARR11(2)       <-----------RAV1(1)     --------->AHL12(3)  -------
     <---------CCA1(2)  <---------ARR14(2)    <----------DOF2          --------->AHL20(2)  <--------
  <---------LBD16   <---------HSFB2a(2)      <---------DOF5.7(1)  <-------TEIL --------->KAN1<------
----CCA1(2) <---------At4g35610          ---------->ID1<---------ZAT18 --------->AHL12(3)  ---------
 
tcttctctggatctcttctgattctcgaatccctatttgtcttcgtcttcttttgttgtgaacttgcgatacatatatatatagatgcgagtacaccgga  22319300
                                                                                             <------
                                                                                            <-------
                                                                                          --------->YAB1
                                                                                          <---------ICU4
                                                                                         <---------YAB1
                                                                                         <---------YAB5
                                                                        <---------DOF5.7(1) <-------
                                                                ------>ZmHOX2a(2)      --------->YAB1
                                                                ======================HOX2a_HOX2a
                                                               <------ZmHOX2a(2)       <---------ICU4
                                                               =======================HOX2a_HOX2a
                                                              --------->GATA12        <---------YAB1
-------->GT1                                                  <---------GATA12 ------>ZmHOX2a(1)
-->ZAT14                       <---------KAN1                 --------->ARR11(3)   <---------YAB5
-LBD16                  <---------RVE1(2)          ----------->GT1  --------->ANAC58  <---------YAB5
---ZAT14           <---------RVE1(2)           --------->ARR11(3)   --------->ANAC58  --------->ICU4
>ANAC46           --------->ATHB12       <---------HSFB2a(2)  <---------ARR11(3)  <-----------TGA1
 
ctgtgaaattttggaacgaattgatttgatttgaatatggcaatcgcgaagaaattggaaaatgagatctcacgctcttctccttcgtcatcatcatcat  22319400
<- Previous    Next ->

AGI:  At5g54910.1   
Description:  DEAD/DEAH box helicase, putative. Identical to Probable DEAD-box ATP-dependent RNA helicase 32 (RH32) [Arabidopsis Thaliana] (GB:Q9FFT9); similar to DEAD/DEAH box helicase, putative [Arabidopsis thaliana] (TAIR:AT5G65900.1); similar to predicted protein [Physcomitrella patens subsp. patens] (GB:EDQ80934.1); similar to DEAD-box ATP-dependent RNA helicase 32 (GB:Q0D622); similar to unnamed protein product [Vitis vinifera] (GB:CAO38967.1); contains InterPro domain RNA helicase, DEAD-box type, Q motif (InterPro:IPR014014); contains InterPro domain Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); contains InterPro domain DEAD-like
Range:  from: 22315783    to: 22318945    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g54920.1   
Description:  similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G26990.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN82076.1); contains InterPro domain Like-Sm ribonucleoprotein-related, core (InterPro:IPR010920)
Range:  from: 22319227    to: 22323021    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version