AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                     <---------ZAT14
                     <---------ARR11(2)
                     --------->ZAT14
                     --------->ARR11(2)
                     <---------ARR14(2)
                     --------->ARR14(2)
               <------ZmHOX2a(2)
               --------->CCA1(2)
              <---------ARR14(2)
              --------->ARR11(2)                                                   --------->KAN1
              --------->GATA12                                                     --------->YAB5
              <---------ARR11(2)                                                   --------->ATHB12
              --------->AGP1                                                      --------->ICU4
              <---------GATA12                                                    <---------YAB5
              --------->ARR14(2)                             ------>ZmHOX2a(2)  --------->YAB5
              --------->ARR11(3)         --------------->AtSPL8                 <---------ICU4
              <---------ARR11(3)<---------ETT(2)           --------->GATA12    --------->ICU4
        <---------KAN1          --------->ETT(2)       <---------At4g35610     <---------YAB1
       <---------ARR11(2)     <---------GATA12        <---------GATA12       --------->YAB1
       --------->ARR11(2)     --------->GATA12----------->RAV1(2)  ------->GAMYB--------->YAB1
    <---------ANAC46 <---------ZAT18   <-----------HVH21   <---------GATA12<---------At5g28300
-->ANAC46    --------->GLK1(1)--------->ARR11(2)    <-------TEIL <---------REM1(2)<---------YAB1
 
catcgtttcgcatacgagatccagtatactctcgatcgacattgtcagtacctgatacatctgatctcaacacacatttaccatgatgattcgaagtcaa  22013900
                                                                              --------->LBD16
                                                                            <---------LBD16
                                                                            ------>ZmHOX2a(2)
                                                                           --------->CCA1(2)
                                                                           <------ZmHOX2a(2)
                                                                           --------->ARR14(1)
                                                                          --------->GATA12
                                                                          <---------GATA12
                                                                          --------->ARR11(3)
                                                                          --------->ARR14(2)
                                                                          <---------ARR14(2)
                      --------->CCA1(2)                                   --------->ARR11(1)
              <------ZmHOX2a(2)                          ------->GAMYB    --------->AGP1
             --------->AGP1                            --------->WOX13(2) --------->ARR11(2)
             --------->GATA12                         --------->ARR11(2)  <---------RVE1(2)
             --------->ARR11(2)                       --------->MYB52(1)  <---------AGP1
             <---------ARR14(2)                    <---------ANAC55(2)    <---------ARR11(2)
             <---------ARR11(2)                    --------->ANAC58      --------->KAN1
             --------->ARR14(2)                    --------->ANAC55(2)  <-------TEIL
             <---------GATA12                      --------->ANAC58    <--------P
          --------->MYB46(3)                     <<<<<<<ZML2        <---------AtMYB61
          --------->DEAR3(2)                  <---------HSFB2a(2)  <------NtERF2
        --------->ARR14(2)                    --------->HSFB2a(2) --------->LBD16
        <---------ARR14(2)                    <---------HSFC1(1) --------->DEAR3(1)
        <---------ARR11(2)                    --------->HSFC1(1)<---------LBD16   --------->YAB5
        --------->ARR11(2)              ------>NtERF2 <---------ARR11(2)----------->ARR10        ---
 
aacatcagaaggaaccgatctagagaaatgagaactgtttctccgacttctagaacgtaactgactcgccggaggtagatccggctcattactaagtccc  22014000
                                                                                                  <-
                                                                                                 ---
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                                     <---------ARR11(2)
                                                                                     --------->ARR11(2)
                                                                                     --------->ARR14(2)
                                                                                     <---------ARR14(2)
                                   <-------TEIL                                     ================
                                  --------->GLK1(2)                                 ================
                                 <---------ARR14(2)                                 ================
                                 --------->ARR14(2)   --------->At4g35610           <------ZmHOX2a(1)
                          ----------->RAV1(1)         <---------At4g35610          --------->ANAC58
                          <-----------HVH21           --------->ZAT2               --------->ANAC58<
                          ------>NtERF2       <---------GLK1(1)               ======================
          ============================RAV     --------->GLK1(1)               ======================
          ----------->RAV1(2)    <---------GLK1(2)    <---------ZAT2          <------ZmHOX2a(1)  <--
  --------->ANAC58       ----------->HVH21   <---------GATA12                 ======================
  --------->ANAC46       --------->ANAC46    --------->GATA12             --------->TOE1(2)      <--
  --------->ANAC55(1)    <---------ETT(1)    <---------GLK1(2)            --------->TOE2(2)    <----
  --------->ANAC58 <---------CCA1(2)         --------->ARR14(2)    ----------->GT1 --------->ANAC46-
------>ANAC46 <---------GLK1(2)  <---------GATA12   --------->ANAC46    <---------YAB5--------->MYB52(1)
 
aaaccacgcaataacctgattcgtctctccgacacagattcaggctcagatttccacagctcgaacccagaggtaaacataggaacaggaaacggagtcg  22014100
         --------->ARR14(2)
         <---------ARR14(2)
         <---------GATA12
         --------->ARR11(2)
         <---------ARR11(2)
         --------->GATA12
      ------>ZmHOX2a(2)
    <---------GATA12
    <---------ARR14(2)
    --------->GATA12
    <---------ARR11(2)
    --------->ARR11(2)
-----ZmHOX2a(2)
------>ARR11(2)
-------GATA12
-------ARR11(2)
------>ARR14(2)
------>GATA12
=====HOX2a_HOX2a
=============HOX2a_HOX2a                                                       <------ZmHOX2a(2)
======HOX2a_HOX2a                                                             <---------ARR11(3)
---------ANAC46                                                               --------->GATA12
======HOX2a_HOX2a                                                             --------->RVE1(2)
=====HOX2a_HOX2a <---------HSFB2a(1)                                          --------->ARR11(3)
-------ARR14(2)  --------->KAN1                                               <---------GATA12
=============HOX2a_HOX2a<-----------HVH21                                <---------ZAT14
-------RVE1(2)--------->ARR11(2)                                         --------->ZAT14
-----DEAR3(2) <---------ARR11(2)      --------->YAB1                     <---------ZAT18
----->ZmHOX2a(2)<---------YAB5       <---------YAB5                      --------->ZAT18         ---
 
gatcgtggatcgaatcggaaacattcgggtcagagtcgtaatcagagtttgaagttgaacaagagcaagacgatagtacacgatctagagactcatagaa  22014200
                                                                                     <---------YAB5
                                                                                   --------->YAB1
                                                               <---------ANAC58    <---------ICU4
      --------->ICU4                             --------->RVE1(2)                <---------YAB5
     --------------------->WRI1                  <---------GATA12                 <---------YAB1
   <---------YAB5                                --------->GATA12               <---------ICU4   <--
   <---------YAB1                  <----------DOF2        <---------bZIP60(2)   --------->YAB1 <----
  <-----------TGA1            ---------->ID1     <-----------ARR10           --------->YAB1    -----
 --------->YAB1           <----------DOF2 --------->At4g35610  <---------ANAC58<---------YAB5 <-----
------>KAN1       <<<<<<<<<TBF1   <---------DOF5.7(1)--------->MYB52(1)     <-------TEIL      ------
 
acaatcgtcattgttatcttcttcttctactttgtcttctttcttagcttcaaatctaacgacgttgcttcgtcttcgattcatcatcatcatcttcatc  22014300
                                                             <------MYB46(1)
                                                             <------MYB83
                                                             ----------->GT1
                                                           <--------P                       --------
    --------->ANAC58<---------At4g35610                   <-------GAMYB                 <---------HSFB2a(2)
    --------->ANAC58--------->At4g35610                  --------->MYB55(2)             --------->HSFC1(1)
-------YAB1      <---------YAB1                          <---------MYB46(3)             <---------HSFC1(1)
-----ICU4        <---------YAB5              --------->At4g35610                   --------->KAN1
---->YAB1      --------->YAB1                <---------At4g35610    <---------AHL12(1)  --------->HSFB2a(2)
----YAB5      <---------YAB1        ---------->ID1    <----------DOF2        <-----------HVH21  <---
--->ICU4---------->DOF2         <----------DOF2 --------->ZAT14     --------->AHL12(1)<-------TEIL <
 
atgactgaagcaaaagtattatcatctgaaaatgactttgtctctctctgctacagtctttggttggagaaatttttgactgtgagaggttcgagaagag  22014400
                                                               ------>ZmHOX2a(2)
                                                               ==========================HOX2a_HOX2a
                                                              ===========================HOX2a_HOX2a
                                                              <------ZmHOX2a(2)
                                                             --------->ARR11(2)
                                                             <---------ARR14(2)
                                                             <---------ARR11(2)
                                                             --------->ARR14(2)
                                                             <---------GATA12                  -----
                                                      <------ZmHOX2a(1)                ----------->GT1
         <---------ANAC55(2)            <-------GAMYB ===============HOX2a_HOX2a       <----------ID1
  <---------TOE2(3)                    <---------MYB46(3)    --------->GATA12        ----------->GT1
->DOF5.7(1)     --------->YAB1        <---------TOE2(3) <-----------HVH21            --------->DOF5.7(1)
---ZmHOX2a(1) --------->RVE1(2)    <---------ATHB12   ================HOX2a_HOX2a  ---------->DOF2
---------KAN1 --------->GLK1(2)------------>CBF --------->DOF5.7(1)               <------ZmHOX2a(1)
 
gaattagggattacgagaatcaaaaacgaagttcgccaatggaggttgagtaagagaggagtcagatcggagattaatggagagaggaaagagaaaaata  22014500
                                                                           --------->WOX13(2)
                                                                           <---------WOX13(2)
                                                                         <---------AHL20(2)
                                                                        <---------AHL12(3)
                                                                        --------->AHL20(3)
                                                                        <---------AHL25(2)
                                                                        --------->AHL25(1)
                                                                        --------->AHL25(3)
                                                                        <---------AHL25(1)
                                                                        <---------AHL20(3)
                                                              --------->ANAC58
                                                           --------->At4g35610
                                                           <---------At4g35610
                                                           <---------ZAT2<---------AHL25(1)
                                                --------->ALFIN1        --------->AHL20(2)
                                            <------ZmHOX2a(1) --------->ANAC58    ------------>CBF
                                           --------->DOF5.7(1)--------->ANAC46    --------->AHL20(2)
                                --------->LBD16<------ZmHOX2a(1)        <---------AHL20(2)
  <-----------GT1<---------AHL20(2)     <------ZmHOX2a(1)  --------->ZAT2<---------YAB1<---------ARR11(3)
------>GT1   <---------ZAT6   <---------ZAT14--------->ALFIN1--------->ZAT18 ------------>CBF-------
 
gaaataaactgttttagtgtttaatgtccagactccagagagaggaaggaggagggagagagagctcgcaacgattttaattcaattcaatatgtttttt  22014600
                                                                                --------->RVE1(2)
                                                                           <---------YAB1
                                                                       <---------AHL12(3)
                                                                      --------->AHL12(1)
                                                                      <---------AHL12(1)
                                                                      <---------AHL25(3)
                                                                      --------->AHL20(2)
                                                                      --------->AHL20(1)
                                                                      <---------AHL20(1)
                                                --------->TOE2(3)     <---------AHL20(2)
                                           <---------YAB1             <---------AHL25(1)
                                           <---------AHL12(2)         <---------AHL25(2)
                                          --------->AHL12(2)          --------->AHL25(3)
                                          <---------AHL12(2)          --------->AHL12(3)
                                         <---------ICU4               --------->AHL25(2)
                                         --------->YAB1               --------->AHL25(1)
                                         --------->ATHB51            --------->AHL20(2)
                                         <--------HAHB4              --------->AHL12(3)
                                         <---------AHL12(1)          <---------AHL20(2)
                                         <---------AHL25(3)          <---------AHL12(3)
                                         <---------AHL20(2)          --------->AHL25(3)
                      --------->GLK1(2)  --------->AHL12(1)          --------->AHL25(1)
                     --------->YAB1      -------->HAHB4              <---------AHL12(1)
                    <---------ATHB12    --------->AHL25(3)           --------->AHL12(1)
                 --------->YAB5         <---------YAB1             <---------WOX13(2)
                <---------ATHB12        <---------YAB5             --------->WOX13(2) --------->AHL20(2)
            <---------AHL20(2)          <---------ATHB51         <---------AHL20(2) --------->WOX13(2)
      <---------AHL20(2)                --------->ICU4  <---------YAB5<---------AHL12(3)
      <---------AHL25(2)               <---------WOX13(2)        --------->AHL20(2) <---------WOX13(2)
      --------->AHL12(3)               <---------AHL12(2)      <---------WOX13(2)  --------->WOX13(1)
      --------->AHL25(1)               --------->AHL12(2)      --------->WOX13(2)<---------YAB1 <---
      --------->AHL25(2)               --------->WOX13(2)     ----------->GT1<---------RVE1(2) <----
     <---------DOF5.7(1)   <---------YAB1-------->ATHB1<-----------TGA1<---------AHL12(2)  ---------
-->AHL12(2) --------->AHL20(2)      <---------MYB52(1)--------->YAB1 <---------AHL25(1)---------->DOF2
 
tttgttcatttttttttaaatcaataatctattatttctgttaattattaatctaaatcgtcatttagttaaataaatttgattatcaattaaagcgaaa  22014700
                         <---------AHL20(2)
                        --------->AHL20(2)
                        <---------AHL25(2)
                        --------->AHL25(2)
                        <---------AHL12(3)
                        <---------AHL25(1)
                       <---------AHL12(2)
                       --------->AHL12(2)
                      <---------AHL20(3)                                                           <
                      <---------AHL25(2)                   <---------WOX13(2)                   ----
                      --------->AHL12(1)              ----------->GT1                        <------
                      --------->AHL20(3)             --------->DAG2                          <------
                      --------->AHL25(2)            <---------ZAT14                         <-------
------WOX13(2)        <---------AHL12(1)            ---------->DOF2    <---------AHL12(3)   --------
-----AHL12(1)   <-----------GT1           <---------YAB1--------->AHL20(2)                  <-------
-->GT1       ----------->GT1              --------->AHL25(3)        <---------RVE1(2)  <----------DOF2
 
atttagaatcgaaatgtagttacaaaattttatgtaagtaatagtataatttgagtaaagtaaatgaaattgatatatatgtagttagggcttttaatga  22014800
<- Previous    Next ->

AGI:  At5g54200.1   
Description:  WD-40 repeat family protein. similar to WD-40 repeat family protein [Arabidopsis thaliana] (TAIR:AT3G15470.1); similar to OSJNBa0074L08.11 [Oryza sativa (japonica cultivar-group)] (GB:CAE02139.2); similar to unnamed protein product [Vitis vinifera] (GB:CAO39239.1); contains InterPro domain WD40 repeat-like (InterPro:IPR011046); contains InterPro domain WD40/YVTN repeat-like (InterPro:IPR015943); contains InterPro domain WD40 repeat (InterPro:IPR001680)
Range:  from: 22010575    to: 22014302    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version