AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
          ----------------->AGL3
        --------->ANAC46
--------HSFB2a(2)
------->HSFB2a(2)
-------LBD16
-----ARR11(3)                        --------->YAB1
---->ARR11(3)                     --------->YAB1
-----ARR11(2)            ----------->GT1    ---------->DOF2                                ---------
---->GLK1(2)            <---------YAB5   --------->ANAC58                               <---------RVE1(2)
-----ARR14(2)           --------------->AtSPL3                                         --------->ATHB12
---->ARR14(2)          --------->GLK1(2) --------->ANAC58                             <---------YAB1
---->RVE1(2)          <---------GLK1(2)---------->DOF2                              --------->YAB1
----GLK1(1)  --------->ICU4      --------->AHL12(1)         --------->ANAC58       --------->ICU4
----KAN1--------->ANAC58--------------->AtSPL8              --------->ANAC58  --------->ANAC46
--->RVE1(1)<---------------AGL15 <---------AHL12(1)        <---------TOE2(3)  --------->ANAC58
--ANAC81--------->ANAC58<---------------AtSPL8            --------->MYB52(1)  --------->ANAC58     <
 
tctggaagttcaagccaaaattagagaatcgtacaaataatcaaaagcaaagcacaattactaacgaaatcgcaaatgtgtaagcaattttgatttgtaa  20621800
                                                                        --------->DOF5.7(1)
                                                                        --------->DAG2  --------->DEAR3(1)
                  ----------->GT1       ----------->TGA1            <---------RAP2.6(3) --------->DREB2C(2)
          ------>MYB83                  ----------->HVH21          --------->RAP2.6(2)  --------->At1g77200
     <-----------GT1           --------->WOX13(2)         <---------ALFIN1 --------->GLK1(2)      --
  <---------At4g35610  <---------WOX13(2)            --------->ANAC58  --------->DOF5.7(1)        <-
  --------->At4g35610  --------->WOX13(2)       --------->ANAC58--------->ARR11(2)      ----------->HVH21
-->GT1    ------>MYB46(1) --------->MYB59       --------->ANAC58<---------ARR11(2)  <---------ABI4(2)
-------TEIL  --------->LBD16   <---------WOX13(2)    --------->ANAC58 ---------->DOF2  --------->DEAR3(2)
 
aattcatctcaccatccagagaggcaaattaggcaattggccagtgacgacgagccaaacaacaccgtagccgaaaaggttctgagttgcaccgacgagt  20621900
                                                     <------NtERF2
                                                     --------->ATERF1(1)
                                                     ----------->HVH21
                                                    <-----------HVH21
                                                    <-----------TGA1
                                                   <---------ANAC46
                                                   --------->bZIP60(1)
           <------MYB46(1)                         <---------TGA2(1)
           <------MYB83                            --------->TGA2(1)
        <------ZmHOX2a(1)                 <---------ARR11(2)
      --------->LBD16                     <---------ARR14(2)
     <---------LBD16                      --------->ARR11(2)
     <-----------RAV1(2)                  --------->ARR14(2)                            ------>ZmHOX2a(2)
   ------>MYB46(1)                        --------->GLK1(2)                     --------->DOF5.7(1)
   ------>MYB83                     --------->ARR11(2)                      ------>NtERF2
 --------->DEAR3(1)                 <---------ARR11(2)                      <---------HSFB2a(2)
 --------->AtMYB61                --------->LBD16  <---------bZIP60(1)   ------>NtERF2<---------GATA12
 <---------ALFIN1               <---------LBD16    <---------ANAC58  <---------RVE1(2)--------->GATA12
--------->MYB46(3)             --------->MYB52(1)  <---------ANAC58 <---------At4g35610<------ZmHOX2a(2)
------->ARR11(2)           --------->DAG2 ------->TEIL   --------->DEAR3(1)--------->DEAR3(1)
--------ARR11(2)          ---------->DOF2 <---------GATA12 <---------TOE2(2)--------->HSFB2a(2)<----
 
agaaccacccaggaaggtgagacttcagataaagcaccggagacgaatccgatggcgtcaccgaggtttttagctacgccgagaagagcgatctgtttct  20622000
                                                                    <---------ARR14(2)
                                                                    --------->ARR14(2)
                                                                    --------->ARR11(2)
                                                                    <---------ARR11(2)
                                                                 <---------ANAC46
                                                                --------->ATERF1(1)
                                                                <------NtERF2
                                                               <---------ATERF1(1)
                                                               ------>NtERF2
                                                              ----------->HVH21
                                                              <---------DEAR3(1)
                                                              --------->DEAR3(1)
                                                             <------NtERF2            --------->DEAR3(1)
                                       --------->At4g35610   --------->RAP2.3(1)     <-----------RAV1(2)
                                       <---------ATERF1(1)   --------->ATERF1(1)     <------NtERF2
                                       --------->LBD16      <---------RAP2.3(1)      --------->ATERF1(1)
                                      --------->DEAR3(1)    <---------ATERF1(1)     <---------At4g35610
                                      --------->RAP2.3(3)   ------>NtERF2          <---------ANAC46
                                      --------->RAP2.6(2)   --------->LBD16    ------->MYC3
                                     --------->ATERF1(1)   --------->DEAR3(1)  <-------MYC3
                                     --------->ERF1        <---------ATERF1(2)======================
                          <------NtERF2------>NtERF2  --------->MYB52(1)      <---------O2
                         --------->LBD16 --------->DEAR3(1)--------->ATERF1(2)--------->O2
                        --------->ETT(1)--------->RAP2.3(1)<---------DEAR3(1) --------->TGA1a
                       <---------LBD16--------->RAP2.3(2) <---------LBD16     <---------TGA1a
                    <---------WOX13(1)--------->ATERF1(2) --------->ATERF1(1) --------->PIF3(3)
                   <---------ANAC58  --------->RAP2.3(1) ===============================MYC_MYB
                   <---------ANAC58  --------->DEAR3(2)  ------->GAMYB        ----------->RAV1(2)
                  --------->ATHB12   --------->RRTF1(1) --------->DEAR3(1)  <---------ALFIN1     ---
                 --------->ICU4     <---------At4g35610 --------->ANAC46 <---------TCP20 --------->ANAC58
      --------->MYB52(1)<---------ANAC46<------NtERF2 <---------ATERF1(1)--------->PCF2  --------->ANAC58
-----YAB1        <---------YAB1  ---------->DOF2     <---------WRKY38(1) <---------TCP15(1)      ---
 
gattgtagccaagggaagtcttgattgccggagacatagagccgccgaatagatagccaacgccggcgacggattggacccacatggcgcagacgaaaac  20622100
           <---------WRKY18(1)                <---------YAB5
          --------->WRKY45       --------->bZIP60(1)
          --------->WRKY12       <---------bZIP60(1)
          --------->WRKY38(1)    <---------TGA2(1)
         --------->DOF5.7(2)     --------->ANAC58
        <-------GAMYB            --------->TGA2(1)
       <---------MYB46(3)        --------->ANAC58
       --------->MYB55(2)        --------->ANAC46
       --------->MYB52(2)     ----------->HVH21                                             <-------
 --------->MYB52(1)--------->At4g35610 ---------->DOF2                           *TSS      <-------GAMYB
================MYC_MYB       ----------->TGA1<---------YAB1                    <---------DOF5.7(1)
------>ANAC58      --------->GLK1(1)----------->RAV1(1)                        ---------------------
------>ANAC58    <------ZmHOX2a(1)------>NtERF2--------->YAB1                  <----------DOF2   <--
 
tagccatcggtcgttgactaggagctctagtttgtgacgccacaaagtcatcatagtcaaacgctctcaaaactttctatttctttttttttttcgttga  20622200
                                                                                 --------->AHL12(3)
                                                                                 --------->AHL20(2)
                                                                                 <---------AHL12(3)
                                                                                 <---------AHL20(2)
                                                                                 <---------AHL25(1)
                                                                                 --------->AHL25(1)
                                                                                 --------->AHL20(3)
                                                                                 <---------AHL20(3)
                                                                               <-----------TBP
                                                                             <---------AHL12(1)
                                                                             --------->AHL12(1)
                                                                 <---------AHL25(1)
                                                                 <---------AHL25(3)
                                                                 --------->AHL25(2)
                                                                 --------->AHL25(1)
                                                                 <---------AHL25(2)
        <---------ANAC55(2)                                      <---------AHL20(2)
   --------->YAB5     <-----------GT1                            --------->AHL20(2)
  <---------YAB1    --------->ICU4                               --------->AHL20(1)
--MYB52(1)         --------->WOX13(2)                --------->At5g28300   --------->ANAC55(2)
>WRI1   --------->ANAC55(2)         ---------->DOF2 ----------->GT1   --------->YAB5
-----TEIL      ----------->GT1 ---------->DOF2   <---------ALFIN1<---------AHL20(3)  <-----------GT1
 
ttcatatgattacttattttgtaattttcagtttcaaagaaaagtttggacaacaccgtaaatacaaataaaatgtttacttatttatatacaattcatg  20622300
                                                                                 <---------TOE1(3)
                                                       <---------ATHB12          <---------TOE2(3)
                                                     --------->WOX13(1)          <---------TOE1(2)
                                                   <---------YAB5                <---------TOE2(2)
                        ----------->GT1            <---------ATHB12         --------->ANAC58
                    ----------->RAV1(1)            <---------KAN1           --------->ANAC58
                   <----------ID1              --------->ANAC58        <---------ZAT14
                 ------------------------>ANAC81  --------->RVE1(2)    --------->ZAT14
                 --------->ANAC58              --------->ANAC58      --------->ANAC46
<---------TOE1(3)--------->ANAC58              --------->ANAC46 <---------ARR11(2)
<---------TOE2(3)--------->ANAC46       <---------AHL12(2)      --------->ARR11(2)
 
tgtaaggttgagaaacaaataagcaacaagataaaaaaaaaaaaaaaaacacgaatcaatgaagaggtatacacttcacaagcttaggtttaaaaattgg  20622400
                                                                  --------->AtMYB61                -
                                                                 --------->ANAC46                  -
                                                          <---------------AtSPL8              ------
                         --------->LBD16  <---------WOX13(2)   --------->REM1(1)             -------
                   ------->TEIL   --------->GLK1(2)       <---------TOE1(3)                ---------
                   --------->ARR11(2)    --------->MYB52(2)   <-------TEIL        <---------ZAT2   <
             <---------DAG2       ------->TEIL         <----------DOF2            --------->ZAT2 <--
             <----------DOF2    --------->YAB5      <---------ANAC46              --------->At4g35610
  ---------->DOF2 <---------CCA1(2)    <---------MYB52(1) <---------TOE2(3)       <---------At4g35610
 
tttgcaaaagcattcacttttgtatctccccaaaatgaatctgttagtttgagttgcgcttaaggtacaccaaaactccaagtccagcagcaagagcagc  20622500
   <---------At4g35610
   --------->At4g35610
   <------NtERF2
--------->At4g35610                                      ------>ZmHOX2a(1)
--------->ZAT2          ------>NtERF2                --------->RVE1(2)
<---------ZAT2        --------->ATERF1(1)            <---------ARR14(2)              <----------DOF2
----->NtERF2         --------->ZAT2                  <---------ARR11(2)             <---------DOF5.7(1)
-------->LBD16       --------->At4g35610             --------->ARR14(2)            <---------DOF5.7(1)
--->At4g35610        <---------At4g35610             <---------ARR11(3)          <XXXXXXXXXXXXXXXXXX
-->DEAR3(1)          --------->ATERF1(1)             --------->ARR11(2)        <---------ZAT18 -----
>At4g35610<---------MYB52(1)        <---------WRKY18(1)  --------->At4g35610------>ZmHOX2a(1)  -----
---------ATERF1(1) <---------RAP2.6(2)              <---------CCA1(2)     ----------->RAV1(2)  <----
-------LBD16      <---------At4g35610               --------->KAN1    --------->AtMYB61     <-------
 
cccggctgcaaccgttttgtaagcggctgcccatgagtttgactggtcgtagtccatatcctctgaacttagacctctcctgtgccctctttcttctgtg  20622600
                                        ------>MYB83
                                        -------->P
                                        ------>MYB46(1)                                          <--
                                        >>>>>>>>>MYB98                                           <--
                                       <---------ALFIN1                                         ----
                                 <---------GLK1(1)                                              <---
                                 --------->ARR14(2)                                             ----
                                 --------->GATA12                                               <---
                       ----------->RAV1(1)                                                      <---
                      <-----------------AG------->GAMYB                                         ----
XMIR156H              <-----------------AGL1     <-----------GT1    --------->GATA12          ------
---->ZAT14           <---------ZAT14  <---------ALFIN1              --------->ARR14(2)      <-------
---->REM1(2)         --------->ZAT14--------->ANAC46                <---------ARR14(2)      --------
-----ZAT14     <-----------GT1   --------->ARR11(2)                 --------->RVE1(2)       <-------
--ANAC46   --------->YAB1        <---------ARR14(2)      <----------DOF2       ----------------->AGL1
 
tagtccaaatgcaattttaaaccctgcaccatttggaatccccaacccaaatatactcttctttagcccaaaatccacattaaccaaaacgagaccgcgg  20622700
<- Previous    Next ->

AGI:  At5g50630.1   
Description:  nodulin family protein. similar to nodulin family protein [Arabidopsis thaliana] (TAIR:AT5G50520.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN73867.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68316.1); contains InterPro domain MFS general substrate transporter (InterPro:IPR016196); contains InterPro domain Nodulin-like (InterPro:IPR010658)
Range:  from: 20620147    to: 20622182    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g50640.1   
Description:  CBS domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein. similar to CBS domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G50530.1); similar to CBS domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G63490.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN79772.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68312.1); similar to unknown [Populus trichocarpa] (GB:ABK94323.1); contains InterPro domain Cystathionine beta-synthase, core (InterPro:IPR000
Range:  from: 20622444    to: 20625490    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version