AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                     ----------------->AGL3
                                                                   --------->ANAC46
                                                         <---------HSFB2a(2)
                                                         --------->HSFB2a(2)
                                                        <---------LBD16
                                                      <---------ARR14(2)                        ----
                                                      --------->GLK1(2)                      -------
                                                      --------->RVE1(2)             ----------->GT1
    <------ZmHOX2a(2)                                 <---------ARR11(2)           <---------------AtSPL8
   <---------ARR11(3)                                 --------->ARR14(2)           <---------YAB5
   --------->RVE1(2)                <------------------------ANAC81--------->ANAC58--------------->AtSPL3
  <------ZmHOX2a(1)            <----------DOF2        --------->ARR11(3)          --------->GLK1(2)
-------->YAB1                 <---------DOF5.7(1)     <---------ARR11(3)         <---------GLK1(2)--
----->WOX13(1)              <---------ARR11(3)       <---------GLK1(1)  --------->ICU4      <-------
-->GLK1(2)            <----------DOF2                --------->RVE1(1)<---------------AGL15 --------
-->RVE1(2) --------->YAB1   --------->ARR11(3)       <---------KAN1--------->ANAC58--------------->AtSPL8
 
aagcaggatcacactcatatgtaagctttaacatctttttttttttttttttttgaatatctggaagttcaagccaaaattagagaatcgtacaaataat  20588400
                                                  ----------->GT1
   ---------->DOF2                             <---------RVE1(2)
--------->ANAC58                              --------->ATHB12               ----------->GT1       -
--------->ANAC58                             <---------YAB1          ------>MYB46(1)               -
----->YAB1                                 --------->YAB1            ------>MYB83         <---------WOX13(2)
-->YAB1            --------->ANAC58       --------->ICU4        <-----------GT1      --------->MYB59
-------->DOF2      --------->ANAC58  --------->ANAC58        --------->At4g35610  --------->WOX13(2)
--AHL12(1)        <---------TOE2(3)  --------->ANAC46        <---------At4g35610  <---------WOX13(2)
->AHL12(1)       --------->MYB52(1)  --------->ANAC58     <-------TEIL  --------->LBD16   --------->WOX13(2)
 
caaaagcaaagcacaattactaacgaaatcgcaaatgtgtaagcaattttgatttgtaaaattcatctcaccatccagagaggcaaattaggcaattggc  20588500
                                                                      <------MYB83
                                                              ------>MYB83
                                                              ------>MYB46(1)
                                                            --------->DEAR3(1)
                                                            --------->AtMYB61
                               --------->DOF5.7(1)         --------->MYB46(3)
                               --------->DAG2  ----------->HVH21<-----------RAV1(2)
                           <---------RAP2.6(3) --------->DREB2C(2)    <------MYB46(1)          -----
            --------->ANAC58  --------->DOF5.7(1)        --------->ARR11(2)                    <----
            --------->ANAC58 ---------->DOF2   --------->DEAR3(1)--------->LBD16             -------
       --------->ANAC58   --------->RAP2.6(2)  --------->At1g77200 <------ZmHOX2a(1)       <--------
       --------->ANAC58--------->ARR11(2)     --------->DEAR3(2)<---------LBD16           --------->MYB52(1)
---------->TGA1        <---------ARR11(2)  <---------ABI4(2)<---------ALFIN1          --------->DAG2
---------->HVH21 <---------ALFIN1 --------->GLK1(2)      <---------ARR11(2)          ---------->DOF2
 
cagtgacgacgagccaaacaacaccgtagccgaaaaggttctgagttgcaccgacgagtagaaccacccaggaaggtgagacttcagataaagcaccgga  20588600
            ----------->HVH21
            --------->ATERF1(1)
            <------NtERF2                                                                         <-
           <-----------TGA1                                                                       --
           <-----------HVH21                                                                      --
          --------->TGA2(1)                                                                      ---
          --------->bZIP60(1)                                                                    ---
          <---------ANAC46                                                                       ---
          <---------bZIP60(1)                                                                   ----
          <---------ANAC58                                                                      ----
 <---------ARR14(2)                                                                  <------NtERF2--
 --------->GLK1(2)                                                                  --------->LBD16
 <---------GATA12                              ------>ZmHOX2a(2)                   <---------ANAC46<
 ------->TEIL                          --------->DOF5.7(1)                        <---------LBD16---
 <---------ARR11(2)                --------->HSFB2a(2)                         <---------WOX13(1)---
 --------->ARR14(2)                <---------HSFB2a(2)                        <---------ANAC58  ----
 --------->ARR11(2)             ------>NtERF2--------->GATA12                 <---------ANAC58  ----
---->ARR11(2)     <---------TOE2(2)------>NtERF2                             --------->ATHB12   ----
-----ARR11(2)   --------->DEAR3(1)--------->DEAR3(1)  <---------YAB1        --------->ICU4     <----
-->LBD16  <---------TGA2(1) <---------RVE1(2)<---------GATA12               <---------YAB1  --------
-LBD16    <---------ANAC58 <---------At4g35610<------ZmHOX2a(2)  --------->MYB52(1)--------->ETT(1)-
 
gacgaatccgatggcgtcaccgaggtttttagctacgccgagaagagcgatctgtttctgattgtagccaagggaagtcttgattgccggagacatagag  20588700
                           <---------ARR11(2)
                           <---------ARR14(2)
                           --------->ARR14(2)
                           --------->ARR11(2)
                        <---------ANAC46
                       --------->ATERF1(1)
                       <------NtERF2
                      <---------ATERF1(1)
                      ------>NtERF2
                     --------->DEAR3(1)
                     ----------->HVH21
                     <---------DEAR3(1)
                    --------->ATERF1(1)      --------->DEAR3(1)
--------->DEAR3(1)  <------NtERF2           --------->ATERF1(1)
--------ATERF1(1)   --------->RAP2.3(1)     <------NtERF2
---->NtERF2        ------>NtERF2            <-----------RAV1(2)
------->LBD16      <---------ATERF1(1)     <---------At4g35610
------>ATERF1(2)   <---------RAP2.3(1)    <---------ANAC46
------>RAP2.3(3)   --------->LBD16    <-------MYC3
------>DEAR3(1)   --------->DEAR3(1)  ------->MYC3                    <---------WRKY18(1)
----->ATERF1(1)   --------->ATERF1(2)----------->RAV1(2)             --------->WRKY45       <-------
----->RRTF1(1)    <---------ATERF1(2)--------->PIF3(3)               --------->WRKY12       --------
------->At4g35610--------->ATERF1(1) <---------O2                    --------->WRKY38(1)    --------
------NtERF2 --------->MYB52(1)      <---------TGA1a                --------->DOF5.7(2)     <-------
------>RAP2.6(2) <---------LBD16     --------->TGA1a               <-------GAMYB            --------
------>RAP2.3(2)------->GAMYB        --------->O2                 --------->MYB52(2)        --------
----->ERF1   <---------ATERF1(1)<---------TCP20 --------->ANAC58  --------->MYB55(2)        --------
----->DEAR3(2)  ===============================MYC_MYB      --------->MYB52(1)--------->At4g35610 --
----->RAP2.3(1)--------->DEAR3(1)  <---------ALFIN1     --------->ANAC58      --------->GLK1(1)-----
-----At4g35610 --------->ANAC46 <---------TCP15(1)      --------->ANAC58    <------ZmHOX2a(1)------>NtERF2
-->DOF2     <---------WRKY38(1) --------->PCF2  --------->ANAC58  <---------MYB46(3)     -----------
-------->RAP2.3(1)<---------DEAR3(1) ======================================MYC_MYB       -----------
 
ccgccgaatagatagccaacgccggcgacggattggacccacatggcgcagacgaaaactagccatcggtcgttgactaggagctctagtttgtgacgcc  20588800
     <---------YAB1
--TGA2(1)
->TGA2(1)
->bZIP60(1)
--bZIP60(1)
->ANAC46
->ANAC58                                                      --------->YAB5     <-----------GT1
->ANAC58                                           <---------MYB52(1)          --------->ICU4
-------->DOF2                           *TSS      <-------GAMYB    <---------ANAC55(2)
------>RAV1(1)                         <---------DOF5.7(1)   <---------YAB1   --------->WOX13(2)
>TGA1<---------YAB5                   --------------------->WRI1   --------->ANAC55(2)         -----
>HVH21--------->YAB1                  <----------DOF2   <-------TEIL      ----------->GT1 ----------
 
acaaagtcatcatagtcaaacgctctcaaaactttctatttctttttttttttcgttgattcatatgattacttattttgtaattttcagtttcaaagaa  20588900
                                        --------->AHL12(3)
                                        --------->AHL20(3)
                                        --------->AHL25(1)
                                        <---------AHL25(1)
                                        <---------AHL20(3)
                                        <---------AHL12(3)
                                        --------->AHL20(2)
                                        <---------AHL20(2)
                                      <-----------TBP
                                    --------->AHL12(1)
                                    <---------AHL12(1)
                        <---------AHL20(3)
                        <---------AHL20(2)
                        <---------AHL25(1)
                        --------->AHL25(2)
                        <---------AHL25(2)                                         ----------->GT1
                        <---------AHL25(3)                                     ----------->RAV1(1)
                        --------->AHL25(1)                                    <----------ID1
                        --------->AHL20(2)                                  --------->ANAC46
            --------->At5g28300   --------->ANAC55(2)                       --------->ANAC58
----->DOF2 ----------->GT1   --------->YAB5                <---------TOE1(3)------------------------
>DOF2   <---------ALFIN1--------->AHL20(1)  <-----------GT1<---------TOE2(3)--------->ANAC58      <-
 
aagtttggacaacaccgtaaatacaaataaaatgtttacttatttatatacaattcatgtgtaaggttgagaaacaaataagcaacaagataaaaaaaaa  20589000
                                       <---------TOE1(2)
             <---------ATHB12          <---------TOE2(3)
           --------->WOX13(1)          <---------TOE2(2)
         <---------YAB5                <---------TOE1(3)
         <---------ATHB12         --------->ANAC58
         <---------KAN1           --------->ANAC58                                 --------->LBD16
     --------->ANAC58        <---------ZAT14                                 ------->TEIL   ------->TEIL
     --------->ANAC46        --------->ZAT14                                 --------->ARR11(2)    -
     --------->ANAC58 <---------ARR11(2)                               <----------DOF2      --------
>ANAC81 --------->RVE1(2)  --------->ANAC46                            <---------DAG2     --------->YAB5
--------AHL12(2)      --------->ARR11(2)                    ---------->DOF2 <---------CCA1(2)    <--
 
aaaaaaacacgaatcaatgaagaggtatacacttcacaagcttaggtttaaaaattggtttgcaaaagcattcacttttgtatctccccaaaatgaatct  20589100
                                                             <------NtERF2
                                                          <---------ZAT2
                                                          --------->At4g35610
                                                          --------->ZAT2
                        --------->AtMYB61                --------->LBD16       <---------At4g35610
                       --------->ANAC46                  <---------ATERF1(1)   --------->ATERF1(1)
                <---------------AtSPL8              --------->At4g35610        --------->At4g35610
                <---------TOE2(3)                  --------->DEAR3(1)          --------->ZAT2
             <----------DOF2                     --------->At4g35610<---------MYB52(1)        <-----
<---------WOX13(2)   --------->REM1(1)  <---------At4g35610  <---------At4g35610  ------>NtERF2
-------->MYB52(2)   <-------TEIL        --------->At4g35610  --------->At4g35610--------->ATERF1(1)
->GLK1(2) <---------ANAC46              <---------ZAT2   ------>NtERF2       <---------RAP2.6(2)
-------MYB52(1) <---------TOE1(3)       --------->ZAT2 <---------LBD16      <---------At4g35610
 
gttagtttgagttgcgcttaaggtacaccaaaactccaagtccagcagcaagagcagccccggctgcaaccgttttgtaagcggctgcccatgagtttga  20589200
                                                                                                  --
                                                                                                  --
                                                                                                  --
                                                                                                  >>
                                                                                                 <--
               --------->At4g35610                                                         ---------
           <---------ARR11(3)                                                              ---------
           --------->RVE1(2)               <----------DOF2                                 <--------
           <---------ARR11(2)             <---------DOF5.7(1)                    ----------->RAV1(1)
           --------->ARR14(2)            <---------DOF5.7(1)                    <-----------------AG
           <---------ARR14(2)          <XXXXXXXXXXXXXXXXXXXMIR156H              <-----------------AGL1
           --------->ARR11(2)        <---------ZAT18 <---------ZAT14           --------->ZAT14  <---
          --------->KAN1          ------>ZmHOX2a(1)  --------->ZAT14           <---------ZAT14------
          <---------CCA1(2) --------->AtMYB61     <---------ANAC46   --------->YAB1        <--------
----WRKY18(1)  ------>ZmHOX2a(1)----------->RAV1(2)  --------->REM1(2)   <-----------GT1   ---------
 
ctggtcgtagtccatatcctctgaacttagacctctcctgtgccctctttcttctgtgtagtccaaatgcaattttaaaccctgcaccatttggaatccc  20589300
<- Previous    Next ->

AGI:  At5g50520.1   
Description:  nodulin family protein. similar to nodulin family protein [Arabidopsis thaliana] (TAIR:AT5G50630.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN73867.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68316.1); contains InterPro domain MFS general substrate transporter (InterPro:IPR016196); contains InterPro domain Nodulin-like (InterPro:IPR010658)
Range:  from: 20586789    to: 20588841    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g50530.1   
Description:  CBS domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein. similar to CBS domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G63490.1); similar to CBS domain-containing protein / octicosapeptide/Phox/Bemp1 (PB1) domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G50640.1); similar to hypothetical protein [Vitis vinifera] (GB:CAN79772.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO68312.1); similar to unknown [Populus trichocarpa] (GB:ABK94323.1); contains InterPro domain Cystathionine beta-synthase, core (InterPro:IPR000
Range:  from: 20589102    to: 20592159    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version