AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                  --------->LBD16
                                  --------->ANAC46
                                --------->DEAR3(2)
                                --------->MYB46(3)
                               -------->P    <---------WRKY18(1)
                              --------->MYB52(1)
                            <---------MYB52(2)        <---------TOE1(2)
                          --------->YAB5<---------ARR11(3)                              --------->ANAC58
                      --------->DAG2    --------->ARR11(3)                    --------->DAG2
                     ---------->DOF2 ----------->RAV1(1)              ----------->GT1   --------->ANAC58
                 <---------ANAC46------->GAMYB     <---------ANAC46 ------->TEIL       <-------PIF5
                <---------LBD16--------->MYB52(1)<-----------HVH21 --------->MYB52(1)  ------->PIF5
            <<<<<<<ZML2----------->GT1 --------->REM1(1)<---------ARR11(2)   ---------->DOF2
 
gagagaaggaagctagaacgacgggaaagtgactaaccggcaacatcttgaccgtcgtagataccacgatgaacggtaccaaaagtgccacgagcaagaa  20362000
                                                                          --------->REM1(2)
                                                                         <---------MYB52(1)
                                                                       <---------ANAC46
                                                                      <------NtERF2
                                                                     --------->ABI4(1)
                                                                     ------>NtERF2
                                                                    --------->RAP2.3(3)
                                                                    --------->RRTF1(3)
                                                                    --------->RAP2.3(2)
                                                                    --------->DREB2C(2)
                                                                    <---------DEAR3(1)
                                                                    --------->ATERF1(2)
                                                                    --------->RAP2.6(2)
                                                                   --------->ORA47(2)
                                                                   --------->RRTF1(1)
                                                                   --------->RAP2.6(1)
                                                                   --------->RAP2.3(1)
                                                                   --------->ATERF1(1)
                                                                   --------->DEAR4(2)
                                  <---------ATHB12                <---------ATERF1(1)
                                 --------->ANAC58                 ------>NtERF2
                                 --------->ANAC46                 --------->At4g35610
                                 --------->ANAC58                 --------->LBD16
                               <---------ALFIN1               --------->GATA12
                           ------>ZmHOX2a(2)                  <---------GATA12
                           ==============================HOX2a_HOX2a--------->RRTF1(2)
                          <---------GLK1(1)                   --------->ARR14(2)
                         <---------GATA12                     <---------ARR14(2)
                         --------->GATA12                     --------->RVE1(2)
                       ==================================HOX2a_HOX2a--------->DEAR3(1)
                       ------>ZmHOX2a(2)                      <---------ARR11(2)
                     <---------ARR11(2)                       --------->ARR11(2)
                     --------->ARR11(2)                      --------->KAN1
                   --------->HSFC1(2)                        <---------GLK1(1)
      --------->YAB1<------ZmHOX2a(1)                      --------->MYB46(3)
      --------->YAB5==============HOX2a_HOX2a            ----------->RAV1(1)    ----------->HVH21---
     <---------YAB1<---------HSFC1(2)             ------>ZmHOX2a(1)--------->ERF1           >>>>>>>>
  --------->ICU4   <---------HSFB2a(1)        --------->ARR11(2) --------->ANAC46  <-----------RAV1(2)
 
cagtcttgatgataagtttagaaggatcgatctcccactcaagtctctgtttcctcttgccaacaaatccgccgccgtttagagtgacaggggaagaaga  20362100
                         <---------ANAC46
                       <---------KAN1
                 <---------RRTF1(1)
                 <---------ERF1
                 ------>NtERF2
                 ------------>AtMYB77
                 <---------RAP2.3(1)
                <---------RAP2.3(2)
                <---------O2
                --------->O2
               <------NtERF2
               --------->ATERF1(1)
              <---------ATERF1(1)
              ------>NtERF2
             --------->ETT(2)
             ----------->HVH21
             <---------DEAR3(1)
      <------NtERF2 --------->MYB55(2)
    --------->DEAR3(1)<---------MYB52(1)
   --------->MYB46(3)<-------GAMYB
   <---------ABI4(2)<---------DEAR3(2)
 --------->ARR14(2) <---------MYB46(3)
 <---------ARR14(2)<---------DEAR3(1)                                  --------->At4g35610
------>At4g35610<---------DEAR3(1)    <----------DOF2          ---------->DOF2              <-------
>TBF1------>NtERF2<------NtERF2      <---------DOF5.7(1) ---------->DOF2 <----------DOF2    <-------
 
agcagagccaccgatggcgacggcggttgtgtcttcttcatctttcttcttgttcttctctaaagtcaaagctctgcttaagtgtctctctagttgctcg  20362200
                                                                        ------>ZmHOX2a(1)
                                                                       --------->TOE1(2)
                         <---------HSFB2a(2)                          ------>ZmHOX2a(2)
                         --------->HSFB2a(2)                         <------ZmHOX2a(2)
                       --------->At4g35610                          <---------GATA12
                     ------>ZmHOX2a(2)                              --------->ARR14(2)
                     ===========================HOX2a_HOX2a         <---------ARR14(2)
                    <---------At4g35610                             <---------ARR11(3)
                   <---------ARR11(2)                               --------->ARR11(3)
                   --------->ARR14(2)                               --------->GATA12
                   --------->ARR11(2)                              --------->RVE1(1)
                   <---------GATA12      ------>ZmHOX2a(1)        --------->DOF5.7(1)
                   --------->GATA12      ===================================HOX2a_HOX2a
                   <---------RVE1(2)     ====================================HOX2a_HOX2a
              <---------GATA12           <----------DOF2    --------->ANAC58
             --------->WOX13(1)         <---------DOF5.7(1) --------->AtLEC2
           <------ZmHOX2a(2)  --------->MYB46(3)        <-----------HVH21 <---------ATHB12    ------
   <----------DOF2 <---------ARR14(2)  <---------DOF5.7(1)  --------->ANAC58    <----------DOF2
--ANAC58   =====================================HOX2a_HOX2a--------->WOX13(1)------->TEIL     <-----
--ANAC58  --------->GATA12    <---------KAN1     <----------DOF2---------->DOF2<---------DOF5.7(1)
 
tctaagctttttagatcaatctgatctgctcgaacaaacccatcctttccttctttcattgtcaagcaaaagatcctatgaatctttttttggtcttcta  20362300
                                                                                              <-----
                                                                                        --------->DOF5.7(1)
                                                                                       --------->DAG2
                                                                                      ==============
                                                                                      --------->DOF5.7(1)
                                                                                 --------->YAB5
                                                                                 --------->YAB1
         <---------RVE1(2)                                 --------->At4g35610 ---------------------
    <---------MYB46(3)                                    *TSS<------ZmHOX2a(1)--------->RVE1(2)
 <---------MYB46(3)                               <---------YAB5          ----------->GT1     ------
--->HSFB2a(2)                                    --------->RVE1(2)      ---------->DOF2--------->DOF5.7(1)
----HSFB2a(2)                                 <---------RVE1(2)      <----------ID1   ---------->DOF2
 
taagttgttgttgattttgtttcaacaagtttcttctctctctctctcagataatcaaacgcagaggaaaatgggaaaagaaaatcataaaaagggaaga  20362400
                                                                                            <-------
                                                                                            <-------
                                                                                            --------
                                                                                            --------
                                                                                            <-------
                                <-------MYC3            ------->TEIL                        <-------
                            <---------At4g35610         --------->ARR14(2)                  --------
                          --------->ZAT18               --------->ARR11(2)                  --------
                          <---------ZAT18               <---------ARR11(2)                  --------
                    <-------MYC3------->MYC3            <---------ARR14(2)     ---------->ID1
                    ------->MYC3<-------MYC2        <---------TOE2(3)         <-----------GT1
----At4g35610      --------->TGA1a             --------->ANAC46  <-----------GT1  <----------DOF2  <
=============================bZIP_DOF<---------ANAC58  <---------CCA1(2)  <---------DOF5.7(1)<------
--->ANAC81 --------->DOF5.7(1)  ------->MYC2----------->HVH21    <---------AHL20(2)  --------->YAB1<
--->At4g35610      <---------KAN1    <---------ANAC58<---------KAN1      <----------DOF2--------->AHL20(2)
 
tgagaagagaagagaagaccgcatgtgagtgagcacatggtcttgcctcgacgctaatgtatctgtatttacatttctttttttcctttcataaaataaa  20362500
                                                                     <---------AHL20(1)
                                                                     --------->AHL20(1)
                                                                     <---------AHL20(2)
                                                                     --------->AHL20(2)
                                                                     <---------AHL20(3)
                                                                     --------->AHL25(1)
                                                                     <---------AHL25(2)
                                                                     --------->AHL25(2)
                                                                --------->MYB46(3)
                                                               ------>MYB46(1)
                                                               ------>MYB83
                                                               -------->P
                                                              --------->MYB55(1)
                                                             <---------MYB59
<---------DOF5.7(1)                                          <---------MYB111(1)
--AHL12(1)                                                   <---------MYB111(2)
--AHL12(3)                             <---------YAB1        <---------MYB46(2)
->AHL12(1)                         <---------ANAC55(2)  <------MYB46(1)
->AHL25(3)                         --------->ANAC55(2) <---------------AtSPL8
--AHL20(2)                    --------->YAB5           --------------->AtSPL8
--AHL25(1)                    --------->YAB1           <---------AtMYB61
->AHL20(2)                    <---------ICU4        <-----------RAV1(1)--------->WOX13(2)    -------
->AHL12(3)                   <---------YAB5         --------->ALFIN1 <---------AHL25(1)   --------->ZAT18
->AHL25(1)                   --------->ICU4--------->YAB1    --------->MYB46(3)        <---------ANAC58
----------DOF2             --------->YAB1 <---------YAB1<------MYB83 --------->AHL20(3)<---------ANAC58
---AHL25(3)                <---------ICU4--------->RVE1(2)  --------->DEAR3(2)       <---------YAB5
---------DAG2             --------->ICU4--------->YAB1<--------P<---------ATHB12 <---------ZAT14   -
 
tacttttttgttttgtatttccaaaaacaataatcatcacttattatcaaaataagtgttggtaccaaccattttattgacgagaatagtgagtgcaaaa  20362600
                                                                 <---------AHL12(1)
                                                                 --------->AHL20(3)
                                                                 --------->AHL12(1)
                                                                 <---------AHL25(2)
                                                                 <---------AHL20(1)
                                                                 --------->AHL20(1)
                                                                 <---------AHL20(3)
                                       --------->ZAT2            --------->AHL25(2)
                                  --------->CCA1(2)              --------->AHL25(3)
                                 --------->ARR11(1)             --------->AHL12(2)
                                 <---------ARR11(3)  <---------MYB59
           <---------LBD16   ---------->DOF2         --------->TOE2(3)
 ---------->ID1       ------>NtERF2    --------->At4g35610      --------->AHL12(3)     --------->GATA12
--->DOF2  --------------------->WRI1   <---------At4g35610      --------->YAB1         <---------GATA12
-------->MYB59  --------->KAN1   <---------GATA12    --------->TOE1(3)    ----------->GT1
 
gtttggcccattactctggatgttcggcccatcaaagatttgagctccctcgtaaacctaaatacaaaaatattagtatgtgaatttcgacatctacatt  20362700
                                                                                                ----
                                                                                       <---------TOE2(3)
                                                                                   <---------WOX13(2)
                                                                                   --------->WOX13(2)
                                                                                 <---------AHL25(3)
                   <---------YAB5                                               --------->AHL25(3)
    <---------ANAC46                                                            <---------AHL20(2)
 --------->O2      <---------YAB1      <----------DOF2                          --------->AHL12(3)
 <---------bZIP60(2)        <---------YAB1                                      <---------AHL12(3)
 <---------O2<---------ANAC46 <---------RVE1(2)                                 --------->AHL25(1)
 --------->bZIP60(1)       <-----------------AGL2               ----------->GT1 --------->AHL20(2)
 <---------bZIP60(1)--------->YAB1    <---------DOF5.7(1)      <---------TOE2(3)<---------AHL25(1)
 
tttgacgtcgtatgtggagtttatcatacttctgattttggtctttccaacttggtttcacatactatggataaactactaatataaattgatgttacga  20362800
                            ------>ZmHOX2a(2)                               --------->RVE1(2)
                            <---------DOF5.7(1)                            <---------KAN1
                           <------ZmHOX2a(2)                             <---------ANAC58
                          <---------ARR14(2)                             <---------ANAC58
                          <---------GATA12                               <---------ANAC46
            =======================HOX2a_HOX2a                      --------->ALFIN1
            ======================HOX2a_HOX2a                       <---------MYB46(3)
      --------->CCA1(2)   <---------ARR11(2)                  --------->MYB52(1)
      --------->KAN1      --------->ARR11(2)                 --------->GLK1(1)
     <---------ARR11(3)   --------->ARR11(3)                 <---------GLK1(1)
     --------->ARR11(3)   --------->ARR14(2)                 --------->CCA1(2)
     <---------RVE1(2)    --------->GATA12                  <---------ARR14(2)                 <----
     --------->AHL20(1)   <---------ARR11(3)                <---------ARR11(3)                 <----
 ---------->DOF2<-----------ARR10       --------->ATHB12    --------->ARR11(3)             ---------
------->GT1 <------ZmHOX2a(1)<----------DOF2  <---------RVE1(2)  <---------MYB46(3)       <---------RVE1(2)
 
agttaaaagatattaggaagaactaagccgatctttctcatcttgatttgatattgacatgaagatatcggttgtggcatgtctaaacaattggacatgc  20362900
<- Previous    Next ->

AGI:  At5g50000.1   
Description:  protein kinase, putative. similar to protein kinase, putative [Arabidopsis thaliana] (TAIR:AT3G01490.1); similar to flag-tagged protein kinase domain of putative mitogen-activated protein kinase kinase kinase [synthetic construct] (GB:ABK06451.1); contains InterPro domain Protein kinase, core; (InterPro:IPR000719); contains InterPro domain Protein kinase-like (InterPro:IPR011009); contains InterPro domain Serine/threonine protein kinase, active site; (InterPro:IPR008271); contains InterPro domain Tyrosine protein kinase; (InterPro:IPR001245); contains InterPro domain ATMRK serine/threonine protein kinase-like (InterPro:IPR015783)
Range:  from: 20359813    to: 20362359    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version