AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                  --------->TOE2(3)      <---------------------WRI1
             <---------ARR14(3)                 <---------YAB1      ------->GAMYB
             --------->ARR11(3)               --------->KAN1       --------->MYB46(3)
             <---------ARR11(3)             <---------DOF5.7(1)    <---------MYB52(2)
          <------ZmHOX2a(1)                 ------>ZmHOX2a(2)    ----------->RAV1(1)
       <---------LBD16                     <------ZmHOX2a(2)  --------->ANAC58
<------ZmHOX2a(2)                         --------->ARR11(3)  --------->ANAC58
-------->GATA12                           <---------GATA12    --------->ANAC46
---------GATA12       --------->DAG2      <---------ARR11(3)--------->MYB52(1)                    --
-------->RVE1(2)     ---------->DOF2 --------->DOF5.7(1)  <---------MYB52(2)                 -------
>DOF2  <-----------RAV1(2)          ---------->DOF2      --------->At4g35610                --------
 
cggatcaaactcaggaggtcttggtaaagttccatcaacaaaagcgatcttattcttagcatctaacgcaacaaacatcgctattttccaagaagaaaag  19264700
                                                                                 --------->ANAC46
   --------->WOX13(1)                                                       --------->ARR14(2)
  <-------TEIL                              <---------YAB1                  <---------ARR11(2)
 <------ZmHOX2a(2)                        --------->YAB1                    <---------ARR14(2)
<---------GATA12                          <-----------GT1               --------->YAB1
--------->ARR11(2)                      --------->RVE1(2)            --------->YAB5
--------->GATA12                     <---------GLK1(2)               <---------ICU4
<---------ARR11(2)                 --------->LBD16                   --------->YAB1
--------->AGP1                    --------->ANAC46                  --------->ICU4
------->MYB59                     --------->LBD16             ----------->GT1 <---------LBD16
-->DAG2      --------->TOE2(3)   <---------LBD16             --------->DAG2 --------->ARR11(2)
-->DOF2    ------->TEIL  --------->YAB1<---------KAN1        --------->DOF5.7(1)--------->LBD16  <--
 
ttagatccatcaagtacctcagaaacaattgtagtacccggattatcaccattagacaatgcataaggtgaataatgagcatccgcgaaatcgaactgtg  19264800
                                                                                        <------ZmHOX2a(2)
                                                                                       <---------GATA12
                                                                                       --------->GATA12
                                                                    <---------YAB5     <---------ARR14(2)
                                                                  --------->ARR11(2)   --------->ARR14(2)
                                                         <---------ARR14(2)      <---------ANAC58
                                                         --------->ARR14(2)      <---------ANAC58
                                                         <---------ARR11(2)     <---------------AtSPL3
                           --------->AHL25(2)            --------->ARR11(2)     <---------------AtSPL8
              --------->ARR11(3)                         --------->TCP20   <---------YAB1
              <---------ARR11(3)                         --------->TCP16(1)--------->ICU4------>ZmHOX2a(2)
 ----------->GT1           <---------AHL25(2)--------->ANAC58     <---------ARR11(2)   --------->ARR11(3)
-------ARR11(2) ------>ZmHOX2a(2)            --------->ANAC58     <---------ARR14(2)--------->SPL7(1)
 
gaaatggataaactgatgatctcgtagcaaaattttgttgaatcggagacgaaattggtggaaccggtggaatcggtgaagattgagtacgatctggagt  19264900
                <---------WOX13(1)
               <---------ANAC58
               <---------ANAC58
               <---------ANAC46
           ------>ZmHOX2a(2)
           =====================HOX2a_HOX2a
          ======================HOX2a_HOX2a
          <------ZmHOX2a(2)
         --------->ARR14(3)
         <---------ARR14(3)
         --------->ARR11(3)         --------->RAP2.6(2)
         <---------RVE1(2)          ----------->GT1
         --------->GATA12          <------NtERF2
         <---------GATA12          --------->RAP2.3(1)
         --------->AGP1          --------->DEAR3(1)
         <---------ARR14(2)      <---------DEAR3(1)
         --------->ARR14(2)     --------->ATERF1(1)    --------->MYB46(3)
         <---------ARR11(3)    <---------ATERF1(1)  --------->ARR11(2)
        --------->GLK1(1)     ----------->HVH21     <---------ARR11(2)
       ----------->ARR10     --------->SPL7(1)    ------->GAMYB
   <---------ZAT2   --------->GLK1(1) <---------MYB52(1)         <---------GATA12
   ----------->RAV1(2)     ------->PIF5          --------->ANAC46--------->GATA12
   <---------At4g35610     <-------PIF5   <---------DAG2    --------->HSFB2a(2)
   --------->At4g35610   ------>ZmHOX2a(1)<----------DOF2   <---------HSFB2a(2) <-----------GT1
   --------->ZAT2 --------->ATHB12------>NtERF2 <---------LBD16 <---------GLK1(1)--------->WOX13(2)
 <-----------RAV1(2)<---------GLK1(1)--------->At5g28300--------->AtMYB61  --------->ATHB12       --
 
cttctcagctgagatcttgcttgatttcctcgtgcgacgccgtaacttttcaacggaaaccatcgcgaaatctgagcttgatttaactgatttatgaaga  19265000
                                                                      --------->ARR11(2)
                            <---------At4g35610               <------MYB83--------->At4g35610
                            --------->At4g35610               <---------ANAC55(2)
                          <-----------RAV1(2)                 <---------ANAC46
                       <---------ZAT2                         <---------ANAC58
                       --------->At4g35610                    <---------ANAC58
                       --------->ZAT2                         --------->ANAC55(2)
                <------ZmHOX2a(2)                             <---------ANAC55(1)
               <---------GATA12                               <------MYB46(1)
               <---------ARR11(3)                            --------->MYB111(1)
               <---------ARR14(2)                            --------->MYB46(2)
               --------->GATA12                              --------->MYB111(2)
               --------->ARR11(3)              <---------GATA12       --------->GATA12
               --------->ARR14(2)              --------->GATA12 --------->ALFIN1--------->ARR11(3)
               --------->ARR11(2)             <---------KAN1 --------->MYB59    <---------ARR11(3)
               <---------ARR11(2)     <---------ARR11(3)    <---------MYB55(1)----------->ARR10 <---
------->KAN1   --------->RVE1(2)      --------->ARR11(3) <---------ZAT6   <---------At4g35610   ----
 
aacaatcgaaaaacagaagatcgacgagctcagatgaacaagaactcgaagatgtgaagagagttaggtgttgaatcggctgagaacttcgaattccagc  19265100
                                                               <---------YAB5
                                                    <---------HSFC1(2)
         --------->YAB1                             --------->HSFB2a(1)
        <---------YAB1              --------->TOE1(2) --------->GLK1(2)              <------------CBF
      --------->TOE2(3)          --------->GLK1(2)  --------->HSFC1(2)         --------->MYB52(2)  -
      --------->YAB1        ---------->DOF2         <---------HSFB2a(1)        ----------->GT1  <---
------ZAT14              --------->GLK1(2)  >>>>>>>>>TBF1  <---------MYB52(1)  <---------MYB46(3)<--
----->ZAT14              --------->RVE1(2) *TSS>>>>>>>>>TBF1--------->KAN1  ------------>MYB.PH3(2)<
 
gctctgataccataatagaactagagagaatcaaagaatcgaacgaagaagaagaagtttctgttattcatcttaagaaagtttgttacattgagactct  19265200
                                           ------>MYB46(1)      <---------AHL25(3)
                                           --------->ARR11(2)  <---------AHL25(1)
                                           <---------ARR11(2)  --------->YAB1
                                         <---------MYB59       --------->AHL20(2)
                                         ------->GAMYB         <---------AHL20(2)            -------
                        --------->MYB52(1) ------>MYB83        --------->AHL25(1)          <--------
-------->AHL20(2)   <-------TEIL      --------->MYB52(1)     <---------WOX13(2)            ------->TEIL
------DOF5.7(1)  --------->LBD16   --------->ANAC46          --------->WOX13(2)         <---------YAB1
--------DOF2--------->KAN1         --------->ANAC55(2)      <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(l2)   <
-----------TBP <---------LBD16   <-----------GT1            --------->WOX13(1) <-----------GT1    --
 
ctttatatactagagagacccggttcataccggtttatacttaaccgaaccatacaatttcatcaattatatagtctattagtaacttctcatgaatctc  19265300
     <---------AHL20(2)
     --------->AHL12(3)
     <---------AHL12(3)
     --------->AHL25(2)
     --------->AHL25(1)
     <---------AHL25(3)
     <---------AHL25(2)
     <---------AHL25(1)
    <---------AHL20(2)
    <---------AHL20(1)
    --------->AHL20(2)
    --------->AHL20(3)
    --------->AHL25(2)
    --------->AHL25(3)
    --------->AHL25(1)                                                                            <-
    --------->YAB1                                                                                <-
    <---------AHL25(2)             <---------AHL12(1)                                            ---
    <---------AHL25(1)  --------->KAN1            ----------->GT1                                <--
--------->YAB5          --------->YAB5           <---------TOE2(3)                               <--
-->RVE1(2)   <---------ANAC58     <---------ARR14(2)                                            <<<<
-GATA12      <---------ANAC58     --------->ARR14(2)                                       <--------
---------ATHB12        <---------YAB1        <----------DOF2      <---------ARR11(2)       ---------
------->RVE1(2)      <---------CCA1(2) <-----------GT1       <---------ANAC46              <--------
 
aaatcaataaaatttgacttgctcatatcattcggcaaattttcacatctttgatgtaaaattggtgtggaaactggaatccatttgtatttgggattta  19265400
                                                                                    <-------TEIL
                                                                                <---------------AtSPL3
                                                                              <---------MYB52(1)
                                                                             <-------GAMYB
     --------->WOX13(2)                                                     ------>ZmHOX2a(2)      <
  <---------AHL20(2)                                                        <---------MYB46(3)<-----
--------CCA1(1)                                                            <------ZmHOX2a(2) -------
--------RVE1(1)                                                           <---------MYB52(1)--------
------>ARR11(3)                             --------->RVE1(2)             --------->GATA12  <-------
-------ARR11(3)             --------->YAB1  --------->GLK1(2)        --------->ARR14(2)   <---------AHL20(2)
-------RVE1(2)       --------->YAB5         <---------ARR11(3)       <---------ARR14(2)   --------->AHL25(1)
<<<<<RAP2.2          --------->YAB1         <---------GATA12         --------->ARR11(2)   --------->AHL20(2)
-RVE1(2)           --------->RVE1(2) ----------->RAV1(1)             <---------GATA12     <---------YAB1
>GATA12        --------->YAB1       <----------ID1                   --------->GATA12    --------->AHL25(3)
-GATA12    --------->YAB5 --------->RVE1(2) --------->ARR11(3)       <---------ARR11(2)  --------->AHL20(2)
 
gatatttcaatggaccattcacaatcacaaatcacaagaacaacaaaaatctaagagaagataagtagtttgaatccgatcgttaagtacgttttaatta  19265500
                                                                             --------->DOF5.7(1)
                                                                            --------->DAG2
                                                                            --------->DOF5.7(1)
                                                                   --------->TOE1(3)
      <---------DAG2                                    <---------ATHB12   --------->DOF5.7(1)
      <----------DOF2                                  ------>MYB83--------->TOE2(3)
---------ETT(2)                                        ------>MYB46(1)     ---------->DOF2         <
----ICU4                                     ---------->DOF2       ----------->GT1              ----
-->ICU4       ----------->GT1              <---------YAB1         ----------->GT1--------->At4g35610
->WOX13(2)  ---------->DOF2             --------->TOE1(2)         --------->ANAC46    ----------->GT1
--WOX13(2)<---------YAB1                --------->TOE2(2)--------->KAN1   --------->DOF5.7(1)-------
 
tgtcgataactttatgaaagtaaaatgccatagaatacaaaaacatatgaaagaaaccaaacatgctatacgttaaaaaaaaggagatgaagtgaaatgt  19265600
<- Previous    Next ->

AGI:  At5g47445.1   
Description:  transposable element gene. copia-like retrotransposon family, has a 7.6e-84 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea)
Range:  from: 19263573    to: 19265144    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
AGI:  At5g47450.1   
Description:  AtTIP2;3 (Arabidopsis thaliana tonoplast intrinsic protein 2;3); water channel. Identical to Aquaporin TIP2-3 (TIP2-3) [Arabidopsis Thaliana] (GB:Q9FGL2;GB:Q0WNU5;GB:Q53XE4); similar to DELTA-TIP2/TIP2,2 (tonoplast intrinsic protein 2,2), water channel [Arabidopsis thaliana] (TAIR:AT4G17340.1); similar to tonoplast intrinsic protein, putative [Brassica oleracea] (GB:ABD65010.1); contains InterPro domain Aquaporin; (InterPro:IPR012269); contains InterPro domain Major intrinsic protein; (InterPro:IPR000425)
Range:  from: 19265476    to: 19266731    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version