AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                             --------->AHL25(2)
                             <---------AHL25(1)
                             --------->AHL12(1)
                             <---------AHL25(2)
                             <---------AHL12(1)
                             --------->AHL25(1)
                             <--------ATHB1
                             --------->ATHB51
                             <---------ICU4
                             <---------AHL25(3)
                             <---------AHL20(3)
                             --------->AHL20(2)
                             <---------AHL20(2)
                             --------->AHL20(3)
                            <---------YAB1
                            --------->ICU4
                            --------->AHL25(3)
                           <---------AHL12(3)                                                -------
                           <---------AHL20(3)                                                <------
                           --------->AHL20(3)                                                <------
                           <---------AHL25(2)                                                -------
                           --------->AHL25(2)                                                -------
                           --------->AHL12(3)                                                <------
                           --------->AHL12(2)                                                <------
                           <---------AHL12(2)                                                <------
                          --------->AHL12(2)                 --------->DAG2                 <-------
                      --------->LBD16        <---------ARR11(2)                             <-------
                  --------->RVE1(2)          --------->ARR11(2)       <---------YAB1        --------
                  <---------ARR14(2)         <---------ARR14(2)     --------->YAB1          <-------
                  --------->GATA12           --------->RVE1(2)--------->ANAC58              --------
                  <---------GATA12 <---------------AGL15    ---------->DOF2                 --------
         --------->YAB1   --------->YAB1     --------->GLK1(2)--------->ANAC58              --------
       --------->RVE1(2) <---------KAN1      --------->ARR14(2)  --------->WOX13(1)         --------
--------ANAC58    --------->GLK1(2)--------------->AGL15    --------->DOF5.7(1)             <-------
--------ANAC58    --------->ARR14(2) XXXXXXXXXXXXXXXXXXXX>MIR851-5P<---------ATHB12 <---------AHL12(1)
 
gtcttgtgcctatcacaacaaaatccgaataataatttctaaattcagaatccacaaaaaaaaaaaagcaatcaaaattgaaatcaaaaattcaattttt  19030800
                                                        --------->ARR14(2)
                                                        <---------ARR11(3)
-->AHL12(3)                                        --------->LBD16
---AHL20(2)                                      <---------LBD16
---AHL12(3)                                   <---------GLK1(1)
-->AHL25(2)                                   --------->GLK1(1)
-->AHL25(1)                                   --------->ZAT2
---AHL25(3)                                   <---------ZAT2
---AHL25(2)                                   <---------At4g35610
---AHL25(1)                                   --------->At4g35610
--AHL20(1)                                --------->ANAC46                                        --
--AHL25(2)                                --------->LBD16                                        ---
->AHL25(2)                                <---------HSFB2a(2)                                   <---
--AHL20(2)                                --------->HSFB2a(2)                                   ----
->AHL25(1)                               <---------LBD16<---------ARR14(2)                     <----
->AHL25(3)                              <---------LBD16 ------->TEIL                           <----
->AHL20(2)     --------->GATA12    <---------GLK1(2)    <---------ARR11(2)                ----------
->AHL12(1)     <---------GATA12   <---------At4g35610  <---------CCA1(2)                --------->At4g35610
--AHL12(1)   <---------TOE2(3) <-------TEIL--------->LBD16 <----------DOF2      <---------DOF5.7(2)
 
tttatcaaatgaaatttagatttcaatttcaacatacagcttctcccggagctccggtgtatctttgggagtaccaagtgtgttaacgagtcgctgaaac  19030900
                           --------->HSFB2a(2)
                       --------->KAN4(2)
                      <---------HSFB2a(1)
                      <----------TaMYB80
                      --------->HSFB2a(1)
                      <---------HSFC1(2)
                      --------->KAN4(1)                     --------->AtMYB61
                      <---------KAN4(1)           <---------KAN1
                      --------->KAN1             <-----------ARR10
                 --------->HSFB2a(2)             <---------ARR14(2)
                 <---------HSFB2a(2)             ------->TEIL                                   <---
              <---------AGP1   --------->ANAC46  <---------GATA12                        <---------DOF5.7(1)
     <---------LBD16  <---------KAN1             <---------ARR11(1)                     ------>ZmHOX2a(1)
   --------->GLK1(2) ---------->TaMYB80<---------ANAC46    --------->MYB46(3)      ------>ZmHOX2a(2)
  --------->ATERF1(1)<---------KAN4(2) <---------ANAC58 <---------ETT(2)           =================
------->REM1(2) ------>ZmHOX2a(2)      <---------ANAC58 --------->ETT(2)         --------->GATA12
------>ALFIN1 <---------GATA12 --------->ANAC58  --------->GATA12                <---------GATA12
----MYC3      <---------RVE1(2)--------->ANAC58  --------->GLK1(2)               <---------RVE1(2)
--->MYC3      --------->ARR11(3)  --------->MYB52(1)   ---------->ARF1           --------->ARR11(3)
-----ANAC46 <---------YAB5 <---------HSFC1(1)    --------->ARR14(2)              <---------ARR11(3)
-----O2 <---------MYB52(1) <---------HSFB2a(2)  <---------CCA1(2)          ------>ZmHOX2a(1)  ------
->HVH21--------->LBD16--------->HSFC1(2)        <---------ARR14(1)         ===============HOX2a_HOX2a
 
gtggagactccggtattgatctggaatattccagaagcaacggcttgtgtcgaatcttgtcgaccaccattgaatttcctcgttgatcttcctcttcctg  19031000
                                                        <---------GATA12
                                                        --------->ARR11(2)
                                                        --------->ARR11(3)
                                            <---------HSFB2a(2)
                                            --------->LBD16
                                            --------->HSFB2a(2)
                                    <---------DOF5.7(1) --------->ARR14(2)
                                   <---------DOF5.7(1)  <---------RVE1(2)
   --------->GATA12                <----------DOF2      <---------ARR14(2)
   <---------ARR11(3)             <---------DOF5.7(1)   <---------AGP1
   <---------GATA12          <---------ARR11(2)         <---------ARR11(2)
   --------->ARR11(3)        --------->ARR14(2)         <---------ARR11(3)
  <---------CCA1(2)          <---------ARR14(2)         --------->GATA12
<---------------AGL15        --------->ARR11(2)   --------->DAG2  --------->DOF5.7(1)
------GLK1(2)             --------->ANAC46 <---------LBD16------>ZmHOX2a(2)
=HOX2a_HOX2a             <---------HSFB2a(2)=====================HOX2a_HOX2a
>ZmHOX2a(1)              --------->HSFB2a(2)------>ZmHOX2a(1)   ---------->DOF2
 
attctaaatcttgaaaactcatcttcttcgcgaaacctctttttttcctggaaaaattggatctacaaaaagattgagaaattggttatcggagttttct  19031100
                                     ------>ZmHOX2a(2)
                                     <---------ANAC46
                                   <---------ARR11(2)
                                   --------->ARR11(2)
                                   <---------GATA12
                                   --------->GATA12                                            <----
                                   <---------RVE1(2)                                           <----
                                --------->ALFIN1                                              ------
                              <---------ANAC58                                                <-----
                              <---------ANAC58                                                ------
                              <---------ANAC46                                                <-----
                         <---------WRKY38(1)                                                  <-----
                         <---------WRKY12                                                     ------
                        --------->WRKY18(1)                                                   ------
                       <-----------HVH21         --------->CCA1(2)    <---------ARR11(2)      <-----
                --------->MYB52(1) <---------ARR14(2)           --------->DAG2  --------->RVE1(2)---
               --------->DOF5.7(1) --------->ARR14(2)          ---------->DOF2--------->DOF5.7(1)<--
             <---------AHL12(2) <------NtERF2   --------->ARR11(2)    --------->ARR11(2)      <-----
 
ctaatctctgagaaaaaaaaaacgaaggtcaaggcgtggatcgtggagacagatagacgaagattgaaaagcgttttcgaaaaaatcccaaactgatttt  19031200
           --------->At4g35610
         --------->DOF5.7(1)
        ---------->DOF2                               <---------AHL20(2)
        --------->DOF5.7(1)                           <---------AHL12(1)
-----YAB1--------->DAG2                               <---------AHL12(3)
-----AHL20(2)                                         --------->AHL12(3)
--->AHL25(1)                                         --------->AHL20(1)                        -----
----AHL20(2)                                         <---------AHL20(1)                        <----
--->AHL20(2)                                         <---------ARR11(3)                        <----
----AHL12(3)                             <----------DOF2                                       -----
----AHL20(3)                   <---------DOF5.7(1)   --------->AHL25(3)                        <----
--->AHL25(3)                   <---------DAG2       ----------->TBP                  <---------ANAC58
--->AHL20(3)                   <----------DOF2 <-----------GT1                       <---------ANAC58
----AHL25(1)                  *TSS       ------>ZmHOX2a(1)                 --------->ARR11(2)<------
------>WOX13(2)            <-----------GT1<---------DOF5.7(1)          ------>ZmHOX2a(1) -----------
-------WOX13(2)     --------->DAG2     ------>ZmHOX2a(2)      <-----------GT1      <-----------GT1--
----AHL25(2)       ---------->DOF2   <---------RVE1(2)--------->AHL12(1)   <---------ARR11(2)-------
 
aattgagaagaaaaagctgagataaagttgtttcctttttgatccttttatttctatatatttagtaacctctcctcgtttctgtttttcttgccaaatt  19031300
                                                                                    --------->ICU4
                                                                                   --------->AHL12(3)
                                                                                   --------->AHL25(2)
                                                                                   <---------AHL12(2)
                                                                                   <---------AHL12(3)
                                                                                   <---------AHL25(2)
                                                                                   --------->AHL12(2)
                                                                                  --------->AHL12(1)
                                                                                  <--------ATHB1
                                                                                  --------->AHL20(2)
                                                                                  <---------AHL12(1)
                                                                                  --------->AHL25(1)
                                                                                  <---------AHL20(1)
                                                                                  --------->AHL25(2)
                                                                                  --------->YAB1
         <------MYB83--------->GLK1(2)                                            <---------AHL25(3)
         ----------->GT1                                                          <---------ICU4
        --------->MYB59                                                           --------->ATHB51
        <---------AtMYB61                                                         <---------AHL25(2)
 <------------CBF   --------->GATA12                                             <---------ATHB51
---->AHL20(2)       <---------ARR11(3)                                           --------->ICU4
-----AHL25(1)       <---------RVE1(2)                                            --------->AHL25(3)
-----AHL25(3)       --------->ARR11(3)                                           <---------ATHB12
---->AHL25(1)     <---------TOE2(3)                  <---------RVE1(2)   --------->AHL12(2)
-----AHL20(2) <------------CBF                      --------->ATHB12     --------->WOX13(2)
---WOX13(2)   --------->WOX13(2)               <---------YAB1            <---------AHL12(2)      ---
------>AG<------MYB46(1)                     <---------AHL20(2)          <---------WOX13(2)   <-----
---------->CBF<---------WOX13(2)            --------->AHL25(3)       --------->WOX13(2)    <--------
-->WOX13(2)  --------->ATHB12        <---------MYB52(1)              <---------WOX13(2)   --------->WOX13(2)
 
aaacaattggtttggtttattgagattttggtttgggtcagtttgtttttatttttgatttgattcagttttagttaataaacaataatttttagttagt  19031400
                 <---------AHL25(2)
                 <---------AHL12(3)
                 --------->AHL12(3)
                 --------->AHL12(2)
              --------->AHL20(3)
              <---------AHL20(2)
              <---------AHL20(1)
              <---------AHL20(3)
              --------->AHL20(1)
              <---------AHL25(2)
              --------->AHL25(2)
              --------->AHL25(1)
              --------->AHL12(2)
              --------->AHL25(3)
             --------->AHL20(2)
          --------->YAB5
     <---------AHL20(2)
     <---------AHL20(3)
     --------->AHL20(3)
   --------->AHL20(3)
   <---------AHL12(3)
   <---------AHL20(3)                                                --------->AHL20(2)
   --------->AHL12(3)                                                --------->AHL25(1)
   --------->AHL20(2)                                                <---------AHL20(2)           --
   <---------AHL20(2)                                        <---------AHL20(2)<------MYB46(1)   <<<
  --------->AHL12(2)                                         --------->AHL20(2)<------MYB83 --------
  <---------AHL12(2)                                       <---------WOX13(2) <---------AtMYB61 ----
<---------AHL20(1)   <-----------GT1                       --------->WOX13(2) --------->MYB59<------
--------->AHL20(1) <---------AHL20(2)                     --------->YAB1  <------MYB46(1)  <--------
------>AHL20(2)  <---------AHL20(2)               ---------->DOF2    <---------AHL25(1)    ---------
----WOX13(2)<---------YAB1             ----------->GT1  --------->AHL20(2)<------MYB83     <--------
-MYB52(1)<---------YAB1         ----------->GT1----------->GT1      --------->AHL25(3)     ---------
 
ttatatattaatatgattatattttttctcaatatgtgtaaatagttaaaatgtaaagttttaataaaacatttatttggtttggtttagttcagataca  19031500
                                                        <---------DOF5.7(1)
                                                     ------>NtERF2
                                                     --------->ABI4(2)
                                                     <---------ZAT18
                                                  <---------ANAC58                                 <
                                                  <---------ANAC58                            ------
                                                  <------MYB83                               -------
  <---------ATHB12                                <------MYB46(1)                          ---------
------->YAB1                                     --------->MYB46(2)                     --------->YAB1
<<<<<<ARR2                                       <---------MYB46(3)                    <---------ATHB51
->CCA1(2)                                        <---------DEAR3(1)      <---------TOE2(3)<---------YAB1
----->RVE1(2)                                <------MYB46(1)       <---------------AGL15<---------ICU4
-TEIL   --------->AHL20(2)                   <------MYB83<---------MYB52(1)            --------->ICU4
-ARR11(2)                                --------->WOX13(2)     <-----------GT1      --------->YAB1<
>ARR14(2)                       <-----------GT1  --------->MYB52(2)--------------->AGL15-------->HAHB4
-ARR14(2)                 ----------->GT1<---------WOX13(2) <---------WOX13(2)       --------->AHL12(2)
>ARR11(2)                <---------TOE2(3)  --------->MYB59 --------->WOX13(2)   ----------->GT1  --
 
atcaaatcagtttatataagattccactacggtttaaacagttcaatttggttcggtgcccttagtttaactattttaggtgaaagtttaataatgaaaa  19031600
                       ----------->GT1
                   --------->KAN4(2)
                   --------->ARR14(2)
                   <---------ARR14(2)
                  <----------TaMYB80
                  <---------KAN4(1)
                  --------->KAN4(1)
                  --------->KAN1
                  <---------KAN1
                  --------->HSFB2a(1)
         --------->ANAC58
         <xxxxxxxxxxxxxxxxsmallRNA(s)
       <xxxxxxxxxxxxxxxxsmallRNA(s)
       <xxxxxxxxxxxxxxxxsmallRNA(i)
      <---------ZAT18<---------LBD16
      <xxxxxxxxxxxxxxxxsmallRNA(s)
   <xxxxxxxxxxxxxxxxsmallRNA(i)
   <xxxxxxxxxxxxxxxxsmallRNA(s)                                                          <---------RVE1(2)
 <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)                                               <xxxxxxxxxxxxxx
 <xxxxxxxxxxxxxxxxxxxxxxsmallRNA(le3)                                         --------->ATHB12
 <xxxxxxxxxxxxxxxxsmallRNA(s)    <---------YAB1                              <---------YAB1
<---------AGP1    <---------HSFB2a(1)                                 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
--------->GATA12 ---------->TaMYB80                                --------->ANAC55(2)  --------->KAN1
<---------GATA12 ----------->ARR10                                 <---------ANAC55(2)xxxxxxxxxxxxxx
------MYB46(1)   <---------KAN4(2)                               <---------KAN1<---------RVE1(2)
--->DAG2 --------->ANAC58      ----------->GT1                  <---------ARR14(2)   <----------DOF2
--->DOF2<xxxxxxxxxxxxxxxxsmallRNA(i)                            <---------ARR11(2)  <---------ANAC58
>YAB1 <xxxxxxxxxxxxxxxxsmallRNA(i)         --------->KAN1    ------->GAMYB   <---------YAB5
------MYB83      --------->ARR14(2) --------->KAN1 <-------TEIL --------->ARR14(2)  <---------ANAC58
------->MYB59    <---------ARR14(2)<---------RVE1(2)      <-----------GT1 <---------AHL20(2)      <-
 
gtaggtctgggcacgaagcgaatattcggaaaaattgtgatatttgttattcgattcgttttaaccgaatacttgattttatgatttgctttgattcgaa  19031700
<- Previous    Next ->

AGI:  At5g46860.1   
Description:  VAM3 (syntaxin 22); SNAP receptor. Identical to Syntaxin-22 (SYP22) [Arabidopsis Thaliana] (GB:P93654); similar to SYP23 (syntaxin 23), SNAP receptor [Arabidopsis thaliana] (TAIR:AT4G17730.1); similar to SYP23 (syntaxin 23) [Arabidopsis thaliana] (TAIR:AT4G17730.2); similar to hypothetical protein [Vitis vinifera] (GB:CAN75135.1); contains InterPro domain Target SNARE coiled-coil region (InterPro:IPR000727); contains InterPro domain Syntaxin, N-terminal; (InterPro:IPR006011); contains InterPro domain Syntaxin/epimorphin, conserved site; (InterPro:IPR006012); contains InterPro domain t-SNARE; (InterPro:IPR010989)
Range:  from: 19029248    to: 19031231    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version