AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                        <----------DOF2
                                                                                   <---------At4g35610
                                                                                   --------->At4g35610
                                                                                  <-----------RAV1(1)
                   ----------->HVH21                                           <---------ARR14(2)
                 <---------At4g35610                                           --------->GLK1(2)
                 --------->ZAT2                                               <---------KAN1
                 --------->At4g35610                                         --------->HSFC1(2)
                 --------->O2               <---------RVE1(2)                --------->HSFB2a(1)
                --------->LBD16          <-----------------AGL2              <---------HSFB2a(1)
               <-----------RAV1(2)       --------->MYB46(3)                  <---------HSFC1(2)
         <---------DOF5.7(1)         <---------MYB52(2)               --------->ZAT2  <---------At4g35610
        <----------DOF2   --------->YAB5-------->P             <---------ANAC58<---------ARR11(2)
-------->DOF2  <---------HSFB2a(2) <-----------GT1             <---------ANAC46--------->ARR11(2)
-->At4g35610<-----------GT1    <---------TOE2(3)   <---------ZAT6     <---------ZAT2  --------->At4g35610
>YAB1   <---------DAG2   --------->ICU4--------->MYB52(1)      <---------ANAC58--------->ARR14(2)
 
gaaaagcttagcttttttccaggtgacaaagattaatgttactaaccgatattggtgttaagactggcttacaagctgggagtttctgctgcttaaactg  18727400
                                                                                             <------
                   --------->ATHB12                                                          -------
            --------->RVE1(2)                                                     --------->RVE1(2)
      ------>NtERF2--------->YAB5                                                ------>MYB83-------
     >>>>>>>>>AtERF-4                             ------->TEIL                   ------>MYB46(1)
     >>>>>>>>>AtERF-3                        <---------ANAC55(2)               <---------MYB59
   <---------ZAT2  -------->HAHB4           <-------TEIL                     --------->RVE1(2)
   --------->At4g35610                  ----------->GT1                     <---------KAN1   -------
   --------->ZAT2 <---------ATHB12     --------->DAG2                 --------->RVE1(2)      <------
   <---------At4g35610                ---------->DOF2            ----------------->AGL1     <-------
 
atacagagctgccaaaatcaaatgattcaatgttcagttcaaaaagttacatgaatctataaacaattgccaaaatcgaataccaaatcacagcattttt  18727500
                                                                                            --------
                                                                                           =========
                                                                                  ------>ZmHOX2a(2)
                                                                                <---------ARR11(2)
      <---------WOX13(2)                                                        --------->ARR14(2)
   <---------MYB52(1)         --------->MYB52(1)                       <-----------GT1     ------>ZmHOX2a(2)
  <---------DOF5.7(1)      <---------WOX13(2)   <---------ARR11(3) --------->YAB5 ==================
---AHL20(2)                --------->WOX13(2)   --------->ARR11(3) --------->ATHB12        =========
-->AHL12(3)          --------->At4g35610  <---------WOX13(1)      <---------YAB1<---------ARR14(2)
-->AHL25(1)     ----------->HVH21       --------->ATHB12          <---------YAB5--------->ARR11(2)
-->AHL25(2)    <-----------HVH21       <---------YAB1        <---------ZAT6     <---------GATA12
---AHL25(2)    --------->LBD16---------->DOF2   <---------GATA12  --------->ICU4<---------RVE1(2)
--DOF5.7(1)   <---------ANAC55(2)   <----------DOF2      ---------->DOF2        --------->GATA12
 
tttgcccttacttaaacccgtgagagcttaaactaaaggcttttgattgaagatttcgaagaaagtgttatgattaacctttggatcgtcttgatcgtaa  18727600
                                            <---------ICU4
                                            <--------HAHB4
                                            --------->YAB1
             =======================HOX2a_HOX2a
             <------ZmHOX2a(1)<---------HSFB2a(1)
        <---------RVE1(2)     --------->HSFB2a(1)
     <---------WOX13(1)       --------->HSFC1(2)
   --------->YAB5             <---------HSFC1(2)
   --------->ATHB12         <---------ARR11(2)  --------->RVE1(2)
  <---------KAN1            --------->ARR11(2) <---------ICU4
  <---------YAB1      <-------TEIL          --------->YAB5
<------ZmHOX2a(1)  --------->YAB5          --------->ICU4                            --------->HSFB2a(2)
====================================HOX2a_HOX2a--------->KAN1                        <---------HSFB2a(2)
->TOE1(2) <-----------RAV1(2)<------ZmHOX2a(2)<---------YAB1                    <-------TEIL
=======HOX2a_HOX2a--------->ANAC58         <---------ATHB12             --------->ZAT14
=======HOX2a_HOX2a--------->ANAC58 <---------ALFIN1               <---------MYB59   <---------LBD16
====================HOX2a_HOX2a ------>ZmHOX2a(1)    <---------ALFIN1   <---------ZAT14    >>>>>>>>>TBF1
 
gaaggatgattgatcaggagcacgattcatcgatccttccacttccatcattatcccctctctcgactacttaacttcactgatacatcgggaagaagaa  18727700
                                                                                                ----
                                                                                                <---
                                                                                                ----
               ----------->GT1                                                                  <---
              <------NtERF2                                                                     <---
             --------->LBD16                                 <---------ANAC58                  -----
            <------NtERF2                                    --------->ANAC55(2)               -----
            --------->ALFIN1                                 <---------ANAC55(2)               <----
            <---------ANAC46                            <---------GLK1(2)                     <-----
           --------->LBD16                    --------->ARR11(2)                              <-----
           ------>NtERF2            ----------->HVH21<---------HSFB2a(2)                     <------
           <------NtERF2         <-----------ARR10   --------->HSFB2a(2)                     <------
           <---------LBD16      <---------CCA1(2) --------->GATA12                      ------>ZmHOX2a(2)
          --------->DEAR3(1)    <------NtERF2 <---------ARR14(2)            --------->GATA12 -------
         --------->ATERF1(1)   ------>NtERF2  --------->GATA12              <---------GATA12 <------
        <---------ATERF1(1)   <---------ANAC58<---------GATA12             --------->KAN1  <--------
        --------->LBD16       --------->DEAR3(1)  <---------GATA12       <--------P   --------->GATA12
        ------>NtERF2         <---------ANAC58<---------ARR11(2)<---------ZAT18       <---------GATA12
       --------->DEAR3(1)   <---------ATERF1(1) ------>ZmHOX2a(2) <----------DOF2     <---------ARR11(3)
       --------->ANAC46     ------>NtERF2   <---------MYB46(3)  --------->ZAT18       --------->RVE1(2)
      <---------LBD16       --------->LBD16--------->ALFIN1  <---------ANAC58     <---------At4g35610
  --------->KAN1          <---------LBD16 <---------MYB52(1) <---------ANAC46     ----------->RAV1(2)
 
atggtttactccgccgcggggataaaaactccggcgtctctcaccggtggatcgatctagaatcgcgtgctctctggtagattccacctgatctaagatt  18727800
                   *TSS    ----------->GT1
               --------->AHL25(1)
               <---------AHL25(3)
               <---------AHL25(1)
----->AHL25(1) <---------AHL20(2)
------AHL25(2) --------->AHL20(2)
----->AHL12(2) <---------AHL12(1)
------AHL20(2) --------->AHL12(1)
------AHL12(3)--------->AHL25(3)
---->AHL25(3) <---------AHL25(1)                                                                ----
---->AHL12(1) --------->AHL12(3)                                                              <-----
-----AHL12(1) --------->AHL20(2)                                                              ------
----RVE1(1)   <---------AHL20(3)     ---------->DOF2                                         -------
----CCA1(1)   --------->AHL20(3)   <---------AHL25(3)            ----------->GT1            --------
---GLK1(2)   --------->AHL12(2)    --------->AHL20(2)            <----------ID1             --------
---RVE1(2)   <---------AHL12(2)    <---------AHL20(2)   --------->DAG2    --------->DAG2   ---------
-->ARR11(3)  <---------WOX13(2)  <---------WOX13(2)     --------->DOF5.7(1)            --------->YAB1
---ARR11(3)  --------->WOX13(2)  --------->WOX13(2)    ---------->DOF2   ---------->DOF2   ---------
-TOE2(3)----------->GT1  --------->ZAT14        ------->TEIL  ---------->DOF2         ----------->TBP
 
tttttttgaatttgtaaattaatctctcttcagtaaaattaaaagtatatgaacatgaaaaagttgaaaggaaaaaaaaagtttgaactataaaaaaagg  18727900
                                                   <---------MYB111(1)
     ----------------->AG                        ------>MYB83
------->GT1                                      --------->MYB52(1)
-----ID1                                         ------>MYB46(1)                          <---------
----->GT1                                      <---------MYB46(2)                       <---------TOE2(3)
-->DOF5.7(1)                                   <---------MYB59             --------->AHL20(2)
->DOF5.7(1)                                    <---------MYB111(1)       --------->WOX13(2)  -------
->DAG2                    <------ZmHOX2a(1)   --------->ANAC55(2)    --------->ANAC55(2)<---------TOE1(3)
->DOF2            <---------GLK1(2)       <----------DOF2    <---------ANAC46    <---------TOE2(3)
>DOF5.7(1)   <-----------HVH21       ---------->DOF2         ----------->GT1    ---------->DOF2
 
agaaaataaccaaaaatgtcagaaactgaggactaaaattgaaagctttacctaactacttatagggtatatatgtaataaactaaagtttaaggtcagt  18728000
                                                                                                 <--
                                                                                                 <--
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                 ---
                                                                                                 ---
                                                                                                 <--
                                                                                                 ---
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                                <---
                                                                                                ----
                                                                                                ----
                                                                                                <---
                                                                                                <---
                                                                                               <----
                                                                                               -----
                                           --------->YAB5                                     <-----
                                          --------->ICU4                                      <-----
                                          <---------YAB1                                      ------
                                        -------->HAHB4                                        <-----
                                        <---------ICU4                                        ------
                                      --------->AHL20(3)                                     <------
                                      <---------AHL25(2)                                     <------
                                      <---------AHL20(3)                                     -------
                                      <---------AHL20(2)                                     -------
                                    <---------YAB1                                           <------
                                    <---------AHL20(2)                                       -------
                                   --------->AHL25(3)                                        <------
                                   --------->AHL25(1)                                        <------
                                   <---------AHL25(2)                                        -------
                                   --------->AHL20(1)                                        <------
                                   <---------AHL20(1)                                        -------
                                   --------->AHL20(2)                                        -------
                                   <---------AHL20(3)                                        <------
                                   --------->AHL20(3)                                        <------
                                   --------->AHL25(2)                                       --------
                                <---------AHL12(2)                                          <-------
                               <---------AHL25(3)                                           --------
                               <---------AHL20(2)                                          ---------
                              --------->AHL25(1)                                           ---------
                              <---------AHL20(3)                                           ---------
                              --------->AHL20(3)                                           <--------
                              <---------AHL25(1)                                           <--------
                              --------->AHL20(2)                                           <--------
                              <---------AHL20(2)                                           <--------
                              --------->AHL12(3)                                           ---------
                              <---------AHL12(3)                                      --------->YAB5
                              <---------AHL25(3)                                     --------->ICU4
                              --------->AHL12(1)                                   --------->YAB1---
                              --------->AHL25(3)                                   -------->HAHB4<--
                              <---------AHL12(1)                                   <---------ICU4<--
                            --------->WOX13(2)                                    <---------ATHB51
                            <---------WOX13(2) ----------->GT1                    <---------ATHB12
                          <---------YAB1--------->YAB1                            --------->ICU4----
                        ----------->GT1--------->ICU4                           --------->YAB1<-----
  --------->AHL20(2)<---------TOE2(3)--------->YAB1 <---------WOX13(2)  <---------RVE1(2) --------->YAB1
--HVH21          --------->ARR11(3)<---------AHL25(3) --------->AHL20(2)<---------GLK1(2) --------->AHL12(2)
-->WOX13(1)      <---------RVE1(2)--------->YAB1    --------->WOX13(2)<---------YAB5 <---------YAB1
 
cacaaataaacaaaaacatagataatgttgtaattaaatataataatgaatagtcaataaactagataaactattgattcttctaataatgaataataat  18728100
<---------YAB1
-------AHL25(2)
-------AHL25(3)
------>AHL25(3)
-------AHL25(1)
------>AHL25(2)
------>AHL20(2)
------>AHL20(1)
-------AHL12(3)
------>AHL20(3)
----->AHL25(3)
------AHL25(1)
------AHL25(2)
------AHL20(3)
----->AHL20(3)
----->AHL20(2)
------AHL20(2)
------AHL12(3)
-----AHL12(2)
---->AHL12(2)
----AHL12(2)
----AHL25(2)
--->AHL25(2)
----AHL12(3)
--->AHL20(3)
---ICU4
---AHL25(3)
-->YAB1
-->AHL12(1)
---AHL12(1)
-->AHL25(2)
---AHL25(1)
---AHL20(1)
-->AHL20(2)
---AHL20(2)
-->AHL25(1)
-->AHL12(3)
---AHL25(2)
--ATHB1                                                                                          ---
->AHL25(3)                                                                                       ---
--YAB1                                                                                         <----
->ICU4---------->DOF2                                                                         <-----
>AHL12(2)                                                                                   --------
>AHL20(3)                                                          --------->RVE1(2)        ------>NtERF2
>AHL25(2)                                                         <---------GLK1(1)         <-------
-AHL20(3)                                             <---------AHL25(1)                    <-------
-AHL12(2)                                             <---------AHL25(3)                   ---------
-AHL25(2)                                             --------->AHL25(1)                 ===========
-AHL12(3)                                             --------->AHL20(2)                 ------->GAMYB
>AHL12(3)    --------->ATHB12                         <---------AHL12(3)                --------->ANAC46
------>AHL25(1)                         <---------AHL20(2)     --------->ETT(2)         --------->ANAC58
-------AHL20(3)                   --------->ANAC55(2) <---------AHL20(2)                --------->ANAC58
-------AHL20(2)                   <---------ANAC55(2) --------->AHL12(3)           --------->ANAC58
----->AHL12(3)   <---------AHL20(2)     <-----------GT1        <---------ETT(2)    --------->ANAC58
----AHL20(3)<---------YAB1       <-------TEIL        <---------AHL20(2)            --------->ANAC46
 
tttattatacaaagtatgatttaaaagttttaaaaatacatatttacatatactaatttatatatgtcgatatcagaaaaaacaagaagcaacgcagccc  18728200
                                                  <---------ZAT14
                                            <-----------HVH21
                                      <---------ARR11(2)
                                      --------->ARR11(2)
                                      <---------ARR14(2)
      <-----------GT1                 --------->ARR14(2)
------>O2--------->TOE1(3)           <---------KAN1
------>TGA1a                       <---------ANAC46
-----ALFIN1                        <---------ANAC55(2)
----ZAT18--------->TOE2(3)         ----------->GT1--------->ZAT14
->At4g35610                        --------->ANAC55(2)
--ATERF1(1)  <---------YAB1        <---------ANAC58
--At4g35610  <---------YAB5        --------->bZIP60(1)
>DEAR3(1)<---------DAG2            <---------bZIP60(1)
=======MYC_MYB   ------>ZmHOX2a(2) <---------ANAC58                              <---------ATHB12
 
acttcagattaaccttatgatccagacttcttcttatggcgtaactccatcactgaactataccctctcagttctgttcttcaaatcagtgtatgctaaa  18728300
<- Previous    Next ->

AGI:  At5g46150.1   
Description:  LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein. similar to LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein [Arabidopsis thaliana] (TAIR:AT3G12740.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO40351.1); contains InterPro domain Protein of unknown function DUF284, transmembrane eukaryotic; (InterPro:IPR005045)
Range:  from: 18725726    to: 18727820    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version