AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                                                        --------->ANAC58
                                                                                        --------->ANAC58
                   <---------GLK1(2)                <---------GLK1(2)               --------->bZIP60(1)
        ------>MYB46(1)                            --------->YAB5                   <---------bZIP60(1)
<------NtERF2     --------->KAN1               <-----------GT1            --------->ANAC58
----ZmHOX2a(1)  --------->YAB1 --------->TOE2(3)--------->WOX13(2)        --------->ANAC58
>RAV1(1)------>MYB83    ----------->GT1    <---------WOX13(2)  --------->ANAC46----------->GT1   <--
 
ggaggcaaaccaatctctctcatattcttgtaaaacttaaatgccaaatttaactgattctcttccacgagaatggcaagaacagtgacataagccttct  18712600
                                                                                                ----
                  --------->TOE2(3)                                                             <---
               <---------ARR11(3)                                                              <----
           --------->YAB1                                                                     <-----
          <<<<<<<<<ARR2                                                                       ------
          <---------ATHB12                                                                    <-----
         --------->RVE1(2)                       --------->MYB52(1)                     --------->ANAC58
    <------ZmHOX2a(2)     ----------->GT1    --------->RVE1(2)                          --------->ANAC58
    ======================HOX2a_HOX2a   ---------->DOF2             --------->AtMYB61 ---------->DOF2
  <------ZmHOX2a(1)------>ZmHOX2a(1) --------->TOE2(3)          <---------ETT(1)  --------->RVE1(2)
-------STY1(2) --------->RVE1(2)     --------->TOE1(3)       ------->TEIL --------->ANAC46    <-----
 
ggctaggatcacaatcaaaatccttcattttgtgaaaaacccttaaagaatcaaacggcctatgaacccgaccataccctcgacatatcgaaagcaatat  18712700
                                                --------->ZAT2
                                                <---------At4g35610
                                                <---------ZAT2
                                                --------->At4g35610
                                           ------>ZmHOX2a(2)
                                          <------ZmHOX2a(2)
                                         <---------GATA12
                                         <-----------ARR10
                                         <---------ARR14(3)
                                         --------->GATA12
                                         --------->ARR14(3)
                                         --------->AGP1
                                         --------->ARR11(2)
                                         <---------GLK1(2)
                                         --------->ARR11(3)
                                         <---------ARR14(2)
                                         <---------ARR11(2)                         <---------ARR11(3)
       --------->MYB46(3)                --------->ARR14(2)                   --------->TOE2(3)
----->ARR11(3)                           <---------ARR11(3)                   --------->TOE1(3)
------ARR11(3)                           <---------RVE1(2)                  -------->P
-----CCA1(2)                       --------->WOX13(1)                       ------>MYB83
----AHL25(2)                      --------->MYB46(3)                        ------>MYB46(1)
--->AHL20(1)              --------->KAN1<---------CCA1(2)         --------->At4g35610
----ARR11(3)             <---------YAB5----------->ARR10    --------->ICU4<---------MYB59       ----
----AHL20(1)           --------->YAB1 --------->YAB1 <----------DOF2      --------->AtMYB61<--------
 
atcttcactaacaacacaattctcaatcttcattctaacaatcagatcttcagctgctttgaacttattagcagagaccaacctcaagaccatataacca  18712800
                                          <---------ANAC58
                                          <---------ANAC46
                              <---------ARR11(2)
                              --------->ARR14(2)
                              --------->ARR11(2)
                             --------->KAN1
                           <---------ANAC58
                <---------SPL7(1)         --------->ANAC55(2)
               <---------ANAC58           <---------ANAC58
               <---------ANAC58           <---------ANAC55(2)
               --------->ANAC55(2)     <---------MYB52(1)
               --------->ANAC58       <-------GAMYB
               --------->ANAC58    --------->LBD16
              ------->TEIL --------->ANAC55(2)                                        --------->ANAC58
              --------------->AtSPL8 <---------MYB46(3)                            <---------At4g35610
              <-------TEIL <---------ANAC46  <---------ARR11(2)                    --------->ZAT2
          <---------------AtSPL8   ------>NtERF2                                   --------->At4g35610
 <---------GLK1(1)         <---------ANAC58--------->LBD16                         <---------ZAT2
--------->ARR11(3) <-----------------AGL1<---------LBD16                    <----------DOF2
<---------ARR11(3)------->TEIL<---------ARR14(2)                           <---------DOF5.7(1)
------>DOF2   --------------->AtSPL3 --------->DEAR3(1)                  <---------ARR11(3)      ---
---GT1    <---------------AtSPL3 <---------LBD16--------->YAB1        <---------ALFIN1--------->ANAC58
 
aaagaactctgatcatgtacgtacccatttgcgtattccgccgttgcggaatcaaaaactgccatagacttctccacatctttttcagctcgcatcagtt  18712900
                                                                              ----------->RAV1(1)
                                                                             --------------->AGL15
                         <---------WRKY18(1)                                 =======================
                 --------->KAN1                                              <---------------AGL15 <
            <---------ANAC46                                               ------>MYB46(1)         <
            <---------ANAC58                                               ------>MYB83            <
       --------->REM1(2)--------->WRKY12                              <-----------GT1             <-
      ----------->HVH21 --------->WRKY45                            --------->YAB1                <-
     <-----------HVH21  --------->WRKY38(1)                         --------->YAB5           <------
   --------->TOE2(2)    ----------->HVH21                          <---------ATHB12    ---------->DOF2
   --------->TOE1(2)  <----------DOF2        <----------DOF2       <---------YAB1   --------->RVE1(2)
------>YAB1 <---------ANAC58           <---------ICU4          ------------>CBF------------>CBF<----
 
tgataacctgtgaaggcgtgatgttctttgaccacttgaacatcatcactttgctacccattactaaacaatgataccttccaacaatagcaaagaatac  18713000
               <---------KAN1
              --------->RVE1(2)
  <---------YAB1
 <-----------TBP        --------->ANAC58
<---------DOF5.7(1) <---------ZAT2
===============MADS_MADS--------->ANAC58
---------DOF5.7(1)  --------->ZAT2
----------DOF2<-----------ARR10
---------------AGL15--------->At4g35610                     <---------------------WRI1
--------DOF5.7(1)   <---------At4g35610      <---------ANAC58                ------>MYB83
--------DAG2  --------->GLK1(2)              <---------ANAC46  <---------RVE1(2) ---------->DOF2
---KAN1      <---------GLK1(2)               <---------ANAC58<---------YAB1  ------>MYB46(1)
-------GT1 ----------->ARR10   <---------ANAC46     <---------ARR11(2)   >>>>>>>>>>MYB80        ----
 
acctttttatagagaagaatctcagctacgcattacgtcgaacaggttgtgtgcataaacgatttcgataggctcaaaccaaatgaaagaaacacagacc  18713100
                                                                                                  --
                                                                                                 <--
                                                                                           <------NtERF2
                                                                                          --------->LBD16
                                                                                         --------->ETT(1)
                     --------->TOE2(2)         ----------->RAV1(1)                      <---------LBD16
          <---------ARR11(3)                --------->ANAC58                           --------->MYB52(1)
          --------->GATA12        --------->DAG2                                    <------------CBF
          <---------RVE1(2)      ---------->DOF2------------>CBF                 --------->YAB1-----
          --------->ARR11(3)   --------->HSFB2a(2)     ------->TEIL            <---------WOX13(2)---
    --------->ATHB12 --------->TOE1(2)      --------->ANAC58                  --------->WOX13(1) <--
------->GT1 ------>ZmHOX2a(2)  <---------HSFB2a(2)   --------->YAB1       ----------->GT1<---------ANAC46
 
agaaaaatcatttgatcttcaaaacatacgagttccaaaagtgaaggaagcaacaatgaaactcgttacgaactagaaggttaatcaaattgccggagaa  18713200
                                                                                                   <
       --------------->AGL15                                                                       -
      <-----------------AG                                                                  --------
      ==============================================================================================
      <-----------------AGL1                                                                --------
      ----------------->AGL2                                                                --------
      ----------------->AGL3                                                           ----------->HVH21
------->GLK1(2)                                   --------->DOF5.7(1)                ---------------
-------GLK1(2)                                  ---------->DOF2                <---------KAN1     --
------>ARR10                               <---------At4g35610 --------->HSFB2a(2)   <--------------
------>ARR14(2)                            --------->At4g35610 <---------HSFB2a(2)  <---------------
-------ARR14(2)                        <----------DOF2 ----------->ARR10       --------->ALFIN1-----
 
gaatcgctcaccagttttggctagggtttatgaaatgggagactttagctgcaaagagaagagtctctggacgatttagagggtgtctctctaacaggca  18713300
                                                                                  <---------AHL25(2)
                                                                                  --------->AHL25(2)
                                                                                  <---------AHL12(3)
                                                                                  --------->AHL20(3)
                                                                                  <---------AHL20(3)
                                                                                  <---------AHL12(2)
                                                                        <---------TOE2(3)
                                                                        <---------TOE1(3)
                                                                       ---------->DOF2
                                                                      <---------AHL20(2)
                                                                    <---------AHL12(2)
                                                                   <---------AHL12(2)
                                                                  <---------AHL12(1)
                                                                  --------->AHL12(1)
                                                                  <---------AHL12(3)
                                                                  --------->AHL12(3)
                                                                  <---------AHL25(3)
            <-----------GT1                                      --------->AHL20(2)
        <---------AHL20(2)                                       <---------AHL20(1)
   <-------TEIL                                                  <---------AHL20(2)
---------------AtSPL8                                            --------->AHL25(3)
-------------->AtSPL8                                            --------->AHL25(2)
->ANAC58--------->AHL20(3)                                       <---------AHL25(2)
=MADS_MADS <---------YAB1                                        --------->AHL12(3)
->ANAC58<---------AHL20(3)    <---------AHL20(2)                 <---------AHL12(1)
->ANAC46--------->AHL20(2) <---------WOX13(2)                    --------->AHL12(1)
>AGL15  --------->AHL25(3)------>MYB46(1)                        <---------AHL25(3)      <---------AHL12(2)
-------->DOF2        <<<<<<<<<GT-1                 ---------->DOF2--------->AHL25(2)   --------->AHL20(2)
-AGL15  --------->AHL25(1)------>MYB83   --------->ANAC55(2)     <---------AHL25(1) --------->AHL20(2)
--AGL1  <---------YAB1  <---------MYB59  <---------ANAC55(1)     --------->AHL25(1) --------->YAB1
------>RAV1(1)       <-----------GT1     <---------ANAC55(2) <---------AHL20(2)  <---------ICU4
 
acaaagtacatattattacagtattaaccaaatttaaacgaattaagtgtcaacaaaagcttatataaaaaatttaaagtttaaaaattataaaatatgt  18713400
                                <---------AHL25(1)
                                --------->AHL20(2)
                                --------->AHL25(1)
                    -------->ATHB1
                    <---------ICU4
                    --------->YAB1
                    <---------AHL25(3)
                   <---------AHL25(1)
                   --------->ICU4
                   --------->AHL12(1)
                   --------->AHL25(3)
                   <---------AHL12(1)
                   <---------YAB1<---------AHL25(3)                      ------>MYB83
                   --------->AHL20(1)                                    ------>MYB46(1)
                   --------->AHL20(2)                                  <---------MYB46(2)
                   <---------AHL25(2)                                  <---------MYB59
                   --------->AHL25(2)                                  <---------MYB111(1)
                   --------->AHL25(1)                                 --------->ANAC58
                   <---------AHL20(2)                                 --------->ANAC58
                   <---------AHL12(3)                                 --------->ANAC46
                  --------->AHL25(2)                          <---------AHL20(2)
                  --------->AHL12(3)                          <---------AHL12(3)
                  <---------AHL25(2)                         <---------AHL20(2)
                  <---------AHL20(3)                         --------->AHL20(3)
                  --------->AHL20(3)                         --------->AHL25(2)
       <---------------AtSPL8   <---------AHL12(1)           <---------ARR11(3)
       --------------->AtSPL8   --------->AHL12(1)           <---------AHL20(3)
    <---------AHL12(2)          --------->ICU4               --------->ARR11(3)                    -
   <---------ARR11(3)           <---------AHL12(3)           --------->AHL20(2)                    <
   <---------AHL20(3)          --------->AHL25(3)            --------->AHL25(1)                    <
   --------->AHL25(2)      --------->ANAC46                  <---------AHL20(1)                    <
   --------->AHL20(3)  --------->KAN1                        --------->AHL25(3)                    -
   <---------AHL25(2) <---------YAB1                         <---------AHL25(2)                    -
   --------->AHL20(1)<---------AHL25(2)                      <---------AHL25(3)                    -
   --------->AHL20(2)<---------AHL12(2)                      --------->AHL20(1)                   --
   <---------AHL20(1)--------->AHL25(2)                      <---------AHL12(1)                   --
   --------->AHL12(1)<---------AHL20(3)             <---------YAB5   ------->TEIL                 <-
   <---------AHL12(1)--------->AHL20(3) <------ZmHOX2a(2)    --------->AHL12(1) <---------TOE2(3) <-
--------->YAB1    --------->AHL12(2)   --------->GATA12      <---------AHL25(1)---------->DOF2------
 
caacaatattttagtacttaaaattattatgcgaaatatttagatcaatggactactcatctaatatatttgcacctaattttaaagtataaattcaacc  18713500
<- Previous    Next ->

AGI:  At5g46100.1   
Description:  pentatricopeptide (PPR) repeat-containing protein. similar to EMB1025 (EMBRYO DEFECTIVE 1025) [Arabidopsis thaliana] (TAIR:AT4G20090.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO64138.1); contains InterPro domain Pentatricopeptide repeat (InterPro:IPR002885)
Range:  from: 18711543    to: 18712961    Orientation: Reverse
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version