AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                                  --------->MYB46(3)
                                              --------->At5g28300
                   <---------AHL20(2)        <------MYB83                                    -------
                   --------->AHL25(1)        <------MYB46(1)                            <-----------
                  --------->AHL25(3)         ----------->GT1                           -------------
                  --------->AHL20(2)         <---------DEAR3(2)                      ------>MYB46(1)
                <---------GATA12            --------->MYB59                          ------>MYB83
                --------->ARR11(3)          <---------MYB46(3)                      <---------ALFIN1
                --------->GATA12            --------->MYB46(2)     ------->TEIL    ------->GAMYB
              <---------TOE2(3)      --------->MYB52(1)   --------->ANAC58         --------->MYB46(3)
       ------->GAMYB --------->WOX13(2)     <---------DEAR3(1)   <-------TEIL   <-----------GT1
     -------->P <---------ARR11(3)   <-----------GT1      --------->ANAC58     <-----------GT1------
   --------->MYB46(3)<---------WOX13(2)    <--------P    ------->TEIL    <---------TOE2(3)   -------
 
atatgaacaacccaaataagatttaataaacaaaatagattaacgggtcggtaacaaatgtacccaaatgcattttaagtttttaacccacccataaaaa  17024200
                                --------->YAB5
                               <------ZmHOX2a(2)
       --------->YAB1         <---------ARR11(3)
--->DOF2                      --------->ARR11(3)                      <---------AHL12(2)
----AGL15                     --------->RVE1(2)                 ----------->GT1
---->AGL3                 ---------->DOF2                       <----------ID1
--->DAG2       --------->HSFB2a(2)        --------->MYB46(3)---------->DOF2     ------->TEIL   <----
-->DOF5.7(1)   <---------HSFB2a(2)  --------->RVE1(2)    <---------WOX13(2)     <---------AHL12(2)
 
gtgactccaaaaatacttatagaaatactaaaagatcactatccatccactagaccagtaaatgaaagagaaaaaaaaacatgaattttcaaatttgaaa  17024300
                                  --------->ATHB12
                                  <---------ICU4
                                  --------->YAB1
                                  --------->YAB5
                     <---------AHL25(3)
                     --------->AHL20(1)
                     --------->ARR11(3)
                    --------->AHL20(2)
                    <---------AHL12(3)
                   <---------AHL12(2)
            --------->TOE2(3)    <---------ATHB12
            <----------DOF2   <---------AHL20(2)                                           <--------
            --------->TOE1(3)--------->AHL20(2)                                        --------->AHL20(2)
        <---------ALFIN1     <---------AHL25(1)                                        --------->AHL25(1)
       --------->LBD16       --------->AHL25(1)                                        <---------AHL25(1)
      --------->ANAC46--------->CCA1(2)                                                --------->AHL12(3)
<---------AHL20(2) --------->AHL12(2)                                                  <---------AHL20(2)
--------->AHL20(3)<---------AHL12(3)                                                  --------->AHL20(2)
--------->AHL20(2)--------->AHL20(2)                  --------->WOX13(2)       --------->AtMYB61  --
<---------AHL20(3)<---------AHL20(3)                  <---------WOX13(2)   --------->MYB46(3)     <-
--------->AHL25(1)--------->AHL20(3)                 <-----------GT1 --------->TOE2(2)--------->AHL25(3)
<---------AHL25(1)--------->AHL12(3)   <---------TOE2(3)           >>>>>>>>>MYB98------>MYB46(1)  <-
-----YAB5<---------ALFIN1----------->GT1    --------->AHL12(2)    <-----------GT1------>MYB83<------
 
cattttaatccccaactttaaaaatatatggattaaatcattaagttttttttttttaacttagccatttaacatatgaccaccatccatttattttaac  17024400
               <---------------AtSPL8
          <---------AHL25(3)
         <---------AHL12(3)
         <---------AHL20(3)
         --------->AHL25(1)
         <---------AHL25(1)
         --------->AHL20(2)
         --------->AHL12(1)
         --------->AHL20(3)
         <---------AHL12(1)
         --------->YAB1
         --------->AHL12(3)
        <---------YAB5
       <---------AHL20(3)
       --------->AHL20(3)
       <---------WOX13(2)
       --------->WOX13(2)
      <---------ICU4                                                                               -
     --------->ICU4                                                                                <
     <---------YAB1                                                                                -
   --------->YAB1                                                            --------->RVE1(2)    <-
  <---------YAB1                                                            <---------CCA1(2)     <-
  <---------TOE2(3)                                                       --------->AHL20(2)     <--
 <-----------GT1                           <---------RVE1(2)              <---------AHL25(1)     <--
-AHL20(2)<---------AHL20(2)  <----------DOF2                              <---------AHL20(2)     ---
------->WOX13(2)            <---------ANAC58     <---------YAB1           --------->AHL25(1)     <--
--------WOX13(2)   ---------->DOF2        <-----------GT1                 --------->AHL20(3)   <----
--------AHL12(2)----------->GT1      <---------YAB1                  <-------TEIL          <--------
-----GT1<---------YAB1      <---------ANAC58--------->KAN1----------->GT1 --------->AHL12(3)   <----
 
aaattaacataattatatagggtaaagaaatgcttttcttatttttgacattctaattctagggtaaacaaatacatttatatctaatttcaatatttaa  17024500
             --------->AHL20(2)
          <---------WOX13(2)
        <---------AHL20(2)  <---------ARR14(2)
        --------->AHL20(2)  --------->GATA12
--------->AHL12(2)          ------->TEIL
<---------AHL12(3)          <---------GATA12
<---------AHL20(2)      <---------WOX13(1)
<---------AHL25(2)    --------->ATHB12
--------->AHL25(1)    --------->YAB5                              <-----------GT1
-------->AHL25(3)     -------->HAHB4                             --------->KAN1
---------AHL12(1)    --------->ICU4                        ------------>CBF
-------->AHL12(1)    <---------YAB1                       ------>MYB46(1)
--------RVE1(1)   --------->DOF5.7(1)                     ------>MYB83
--------CCA1(1)  --------->AHL25(2)                       ----------->RAV1(1)
-------RVE1(2)   <---------AHL25(1)                     --------->MYB46(3)
-------GLK1(2)   --------->AHL20(2)                     ------->GAMYB       <---------RVE1(2)
------>ARR11(3)  <---------AHL12(3)                   --------->ANAC58      <---------GATA12
-------ARR11(3)  <---------AHL25(2)                   --------->ANAC58      --------->GATA12
-----TOE1(3) <---------AHL25(3)      <-----------GT1--------->MYB46(3)  <---------ARR11(2)    ------
-AHL12(2) --------->WOX13(2)--------->ARR14(2)    --------->AtMYB61     --------->ARR11(2)  <-------
-----TOE2(3)--------->AHL20(2)  ----------->GT1  --------->MYB46(3) <---------LBD16         --------
 
gatttttttttttaaataaaaaaaatgattgaatctggtttaaccaatttgaaccacaacccaacaatttatccggttcgatttggaaatagcaagtgtg  17024600
                                          <-----------HVH21
                              <---------AHL25(2)
                              --------->AHL25(3)
                              <---------AHL25(3)
                              <---------AHL12(1)
                              <---------AHL25(1)
                              --------->AHL25(2)
                              --------->AHL20(2)
                              <---------AHL20(2)
                              --------->AHL12(3)
                              --------->AHL25(1)
                              <---------AHL12(3)
                              --------->AHL12(1)
                             --------->AHL20(2)                                  ---------->DOF2
                             --------->AHL12(3)                                ------>NtERF2
                             <---------AHL20(2)                                --------->LBD16
                             <---------AHL12(3)                                <------NtERF2
                             <---------AHL20(3)                               --------->RRTF1(2)
                             --------->AHL25(3)                               --------->RRTF1(3)
                             <---------AHL25(2)                               --------->RAP2.3(2)
                             <---------AHL25(1)                               --------->RAP2.6(2)
                             --------->AHL20(3)                               --------->RAP2.3(3)
                            <---------AHL12(2)                                --------->DEAR3(1)
                         --------->AHL20(2)----------->HVH21                 --------->RAP2.3(1)
                       ----------->GT1  *TSS                                 --------->RRTF1(1)
                     ---------->DOF2    --------->LBD16                    ------->GAMYB
                   <<<<<<<<<ARR2       <---------ANAC46             <---------ZAT14
        <---------bZIP60(1) --------->AHL12(2)                      --------->ZAT14
  <---------MYB52(1)--------->YAB1     <---------ANAC58  <---------At5g28300------>NtERF2
 <-------GAMYB     <---------ATHB12    <---------ANAC58----------->HVH21   --------->DEAR3(1)
<---------ZAT6    --------->RVE1(2)  ------>ZmHOX2a(1) <---------KAN1     --------->MYB46(3)
--->ALFIN1     ------------>CBF<---------AHL25(3)  --------->DOF5.7(1)    --------->DEAR3(2)
----RAV1(1)   --------->YAB1<---------WOX13(2)   ---------->DOF2    --------->WRKY38(1)
->ALFIN1--------->bZIP60(1) --------->WOX13(2) <---------MYB59     <---------MYB52(1)          <----
 
ggactgttatgaggtcatcacaatcaaagtaaattaattcctccgtgtgacctaaagagtgaccgttcccgttcactaccgccgcaaagtcttgtggcta  17024700
                                                          <---------At4g35610
                                           --------->ARR14(2)
                                           <---------ARR11(2)               --------->ARR11(2)
                                           <---------ARR14(2)               <---------ARR11(2)
                                           --------->ARR11(2)              --------->GLK1(1)
                                          --------->GLK1(1)           --------->LBD16
                            <---------AHL12(2)  <---------MYB52(1)<---------ARR11(2)
                            --------->AHL12(2) --------->LBD16    --------->RVE1(2)
                            <---------AHL20(3)<---------ANAC46   --------->KAN1
                            --------->AHL20(3)<---------ANAC58 <---------ANAC58        <---------ZAT14
      ----------->GT1  --------->ANAC46   <---------GLK1(1)    <---------ANAC58    --------->YAB5---
-----ZAT14  <-----------GT1<---------AHL12(1) <---------ANAC58 <---------ANAC46   --------->WRKY38(1)
 
cagagcttagggtttaaactttcttcacgataattttccgatgggagttccgtcgttctacagatggcttatccagaggtatccattgactatacaagaa  17024800
                                        --------->YAB5
                                       <---------YAB1
                                    <------NtERF2
                                   <-----------HVH21
                                   <-----------TGA1
                                   ------>NtERF2
                                  --------->bZIP60(1)
                                  --------->bZIP60(2)
                                  --------->O2
                                  <---------bZIP60(1)
                                 <------NtERF2
                                 --------->RAP2.3(1)
                                 --------->ATERF1(1)
                                 --------->RRTF1(1)
                                <---------ATERF1(1)
                                ------>NtERF2
                                <---------RRTF1(1)
                                <---------RAP2.6(1)
                                <---------ORA47(2)
                                <---------RAP2.3(1)
                                <---------ERF1
                                <---------DEAR4(2)
                               <---------DEAR3(1)
                               --------->DEAR3(1)
                               <---------ANAC46
                               <---------RAP2.3(2)
                               <---------RAP2.3(3)
                              --------->ATERF1(1)
                              <------NtERF2
                              --------->RAP2.3(1)
                              <---------ABI4(1)
                              --------->DREB2C(1)
                              --------->DEAR4(2)
                              <---------At4g35610
                              --------->At4g35610
                             <---------RAP2.6(1)
                             ------>NtERF2
                             <---------ATERF1(1)
                             <---------RRTF1(1)
                             <---------DEAR4(2)
                             <---------RAP2.3(1)                            --------->ARR11(2)
                             <---------ORA47(2)                             <---------ARR11(2)
                             <---------ERF1                            --------->MYB52(1)    <------
                            <---------DREB2C(2)                       ------>ZmHOX2a(1)     --------
                            <---------RRTF1(3)                      --------->YAB1    --------->YAB5
                            <---------RRTF1(2)                   ------>MYB46(1)      --------->YAB1
                            <---------RAP2.3(3)                <---------MYB59 <---------ANAC46
                            <---------RAP2.3(2)                --------->TOE2(3)   <---------KAN1
                            <---------DEAR3(1)          --------->ANAC46  --------->YAB5    --------
                            <---------ANAC46            --------->ANAC58  <---------MYB46(3)<-------
            <---------ALFIN1<---------ATERF1(2)         --------->ANAC58  <---------ICU4    <-------
       --------->DOF5.7(1)  --------->ATERF1(2)         --------->AtLEC2 <---------YAB5   --------->GLK1(2)
------>ARR11(3)             <---------RAP2.6(2) <---------ATHB12 ------>MYB83  <---------ANAC55(1)
 
gttattgaagaagagccactcgaagttaatggcggcggcgtcacgattccaatcgattcaagcaaacctaatcctaatggttacgagtatgacaatcttt  17024900
               --------->YAB5
              <---------YAB5                                     <---------ANAC55(2)
              <---------KAN1                                     --------->ANAC55(2)
              <---------ATHB12                                   --------->ANAC58
         --------->ANAC58                                        <---------HSFB2a(2)
----DOF2 --------->ANAC46                                        --------->ANAC58
->YAB5   --------->ANAC58                          --------->HSFB2a(2) --------->ALFIN1
->YAB1  ------->TEIL   XXXXXXXXXXXXXXXXXXXX>MIR774B*             --------->HSFB2a(2)              <-
--ICU4 --------->MYB52(1)           ------>ZmHOX2a(1)           <---------LBD16    --------->KAN1---
--DOF5.7(1)   --------->ICU4<-----------GT1   --------->HSFB2a(1)--------->ANAC46 ------->TEIL   ---
 
atctcgacatgaacggaatcattcatccatgtttccatcctgaagacaaaccttctccaactacatttacggaagtgtttcaatgtatgttcgattacat  17025000
             <---------YAB5
             <---------TOE2(3)       <---------YAB5
     <---------DOF5.7(1)        <---------DOF5.7(1)
    <---------DAG2            <---------ARR11(3)
    <----------DOF2     --------->TOE1(1)  <---------RVE1(2)     --------->YAB5
--------RVE1(2)        <---------LBD16<---------ICU4          ---------->ID1
------>YAB1  <---------TOE1(3)--------->ARR11(3)    <---------ANAC58
------>ATHB12<---------YAB1  <---------At4g35610    <---------ANAC58       <-----------GT1 <--------
 
tgataggctttttgttatggttcgacctcggaagctcttattcatggctattggtgagtgtttttgtctcattacattttacgaattggtttttaagttt  17025100
<- Previous    Next ->

AGI:  At5g42540.1   
Description:  XRN2 (EXORIBONUCLEASE 2); 5'-3' exonuclease/ nucleic acid binding. similar to XRN3 (5'-3' exoribonuclease 3), 5'-3' exoribonuclease [Arabidopsis thaliana] (TAIR:AT1G75660.1); similar to hypothetical protein OsJ_004151 [Oryza sativa (japonica cultivar-group)] (GB:EAZ14326.1); similar to putative 5-3 exoribonuclease [Oryza sativa (japonica cultivar-group)] (GB:BAB86550.1); similar to hypothetical protein OsI_004507 [Oryza sativa (indica cultivar-group)] (GB:EAY76660.1); contains InterPro domain Zinc finger, CCHC-type; (InterPro:IPR001878); contains InterPro domain Putative 5-3 exonuclease; (InterPro:IPR004859); contains InterPro domain Exonucle
Range:  from: 17024641    to: 17032029    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version