AthaMap TU-Logo
Search
 
   Position
Exon region
Intron region
UTR region
AGI
% Restriction to highly conserved TF binding sites (0-100)
 
Go to graphical and table display 

1        10        20        30        40        50        60        70        80        90        100 
                                   <---------AHL20(2)
                                   --------->AHL20(2)
                                   <---------AHL20(3)
                                   --------->AHL20(3)
                                   --------->AHL25(1)
                                   --------->AHL25(3)
                                   <---------AHL25(2)
                             <---------TOE2(3)
                           <---------AHL25(3)
                           --------->AHL25(1)
                           --------->AHL20(2)
                           <---------AHL20(2)
                          --------->AHL20(2)
                          <---------AHL20(2)
                          --------->AHL20(3)
                          <---------AHL20(3)
                          <---------AHL25(1)
                         <---------WOX13(2)
                         --------->AHL12(2)
                         --------->WOX13(2)
                       --------->AHL20(2)
                       <---------AHL20(1)
                       --------->AHL20(1)
                       <---------AHL20(2)
                       <---------AHL25(2)
                       --------->AHL20(3)
                       --------->AHL25(2)
                       <---------AHL25(3)
                       <---------AHL25(1)
                       <---------AHL20(3)
                       --------->AHL25(1)
                      --------->AHL20(2)
                      --------->AHL25(3)
                     --------->AHL12(2)
                  <---------AHL12(1)
                  --------->AHL12(1)
                  <---------AHL20(3)
                  --------->AHL20(3)
                  --------->AHL25(2)
                  --------->AHL20(1)
                  <---------AHL20(1)                                       --------->GLK1(1)
          xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(le3)                         <---------YAB5
     --------->YAB1<---------AHL12(1)       --------->ATHB12          <---------ANAC46
    <---------YAB1<---------AHL25(2)    --------->MYB52(1)          --------->ZAT14
   --------->RVE1(2) <---------AHL12(2) <-----------GT1             <---------ZAT14          <xxxxxx
--------YAB1      --------->AHL25(3) <---------AHL12(2)        <---------YAB1       <-----------GT1
----AHL12(3)     --------->AHL12(2)--------->AHL25(2) <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(s2)   <xxxxxx
----AHL20(2)     --------->YAB1--------->YAB5<---------RVE1(2)--------->RVE1(2)<----------DOF2 -----
----AHL20(3)     --------->AHL12(3)<---------AHL25(1)<xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) <xxxxxxxx
 
tatgagtatcataagcccaaaaatattaaattaatgaataaaataactgatttgggtttaagtagtatcactggagtgatttctttgataccagtctctg  16567900
                                                        <---------AHL25(1)
                                                        <---------AHL25(2)
                                                        --------->AHL25(1)
                                                        <---------AHL12(3)
                                                        <---------AHL20(2)
                                                        --------->AHL12(3)
                                                        --------->AHL25(2)
             --------->YAB5                             <---------AHL25(3)
             --------->YAB1                            --------->AHL25(3)
             --------->ATHB12                          <---------AHL20(2)
            <---------YAB1                             --------->AHL25(2)
        <-------GAMYB                                  --------->AHL20(2)
       <------NtERF2                                   --------->AHL12(3)
      <---------MYB46(3)                               <---------AHL12(3)
      --------->LBD16                                  <---------AHL25(1)
     <---------ANAC46                                  --------->AHL25(1)
     <---------ANAC58                                  <---------AHL25(2)
     <---------ANAC58                                  <---------AHL25(3)
    <------NtERF2                                      --------->AHL12(1)             <----------DOF2
  --------->ALFIN1                                     <---------AHL12(1)            <---------DOF5.7(1)
<---------ANAC58                                      --------->AHL25(3)            <---------KAN1
<---------O2<---------YAB5                            <---------AHL25(2)           ------->TEIL
<---------bZIP60(2)                                   <---------AHL12(3)        --------->ANAC46
<---------ANAC58                                      --------->AHL12(3)        --------->ANAC58
<---------ANAC46 --------->MYB52(2)                   --------->AHL12(2)        --------->ANAC58
xxxxxxxxxxxxxxxxxsmallRNA(fl3)                        --------->AHL12(1)  <------NtERF2
xxxxxxxxxxxxxxxxxsmallRNA(si3)               --------->DOF5.7(1)         <---------HSFB2a(2)    <---
---->YAB1   --------->ICU4                 ---------->DOF2         <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(se3)
xxxxxxxxsmallRNA(i)                   <---------ANAC46<---------AHL12(1)<---------LBD16     <-------
 
ataacgtggcgggttatgattagttgggaaaacatgtttttgtgtgaaaagagagaaattttttttttcgattagtcgggaaaacgcatcttttcgattt  16568000
                                                                                                  <-
                                                                                                  <-
                                                                                                  --
                -------->HAHB4                                                                    <-
                --------->YAB1                                                                   <--
                --------->YAB5                                                                   ---
               <---------YAB5                                                                    ---
               <---------YAB1                                                                    ---
              <---------TOE2(3)                                                                  <--
             --------->YAB1                                   --------->YAB1                     ---
   --------->AHL25(2)                                        <---------YAB1                      ---
   <---------AHL25(2)                                       --------->AHL20(2)                   ---
   <---------AHL20(2)                                       --------->AHL20(3)                  ----
   --------->AHL12(3)                                       <---------AHL25(2)                 <----
   <---------AHL25(1)                                     --------->ICU4                      <-----
   --------->AHL25(1)                                  <---------YAB1                        -------
   <---------AHL25(3)                                 <-----------GT1                        <------
   <---------AHL12(3)                                --------->YAB1                          -------
  <---------AHL12(1)                                <---------YAB1                           <------
  <---------AHL20(2)                               <---------AHL12(2)                        -------
  --------->AHL20(2)                               --------->AHL12(2)                        <------
  <---------AHL25(2)                             <---------AHL12(1)                       --------->TOE2(3)
  --------->AHL12(1)                             --------->AHL12(1)                      <---------ICU4
  <---------AHL20(1)                             --------->AHL25(3)                     <---------YAB5
  --------->AHL25(3)                           --------->GATA12                      --------->AHL20(2)
  --------->AHL25(2)                     --------->ARR11(2) --------->AHL25(2)      <---------AHL12(2)
  --------->AHL25(1)                     <---------ARR11(2) <---------AHL20(3)     <---------AHL12(2)
--------GT1 <---------AHL20(2)    <---------LBD16--------->AHL20(2)---------->DOF2--------->AHL20(2)
--RVE1(2)  <---------AHL20(2)   <-----------GT1<---------GATA12 <---------YAB1   --------->AHL20(2)
 
tgcaattttttttttttaatgatactaatacgatttcaccggtggaaacagatttattatcaatattataaaaagtttcaaacaataaataaacattaaa  16568100
             --------->AHL12(2)
           --------->AHL20(3)
           <---------AHL12(3)
           --------->AHL12(3)
          <---------AHL25(3)
          <---------AHL20(3)
          --------->AHL12(3)
          <---------AHL12(3)
          --------->AHL20(3)
          --------->AHL25(2)
          --------->AHL12(2)
          <---------AHL12(2)
          <---------AHL25(2)
        --------->AHL25(3)
        <---------AHL12(1)
        <---------AHL20(2)
        --------->AHL20(1)
        <---------AHL20(1)
        --------->AHL25(2)
        <---------AHL25(2)
        <---------AHL20(3)
        --------->AHL12(1)
        --------->AHL20(2)
       --------->AHL12(2)
       <---------AHL12(2)
  ----------->GT1
  --------->YAB1
--------AHL20(2)
--------AHL25(3)
------->AHL20(2)
--------AHL25(1)
-------AHL12(3)
------>AHL20(2)
------>AHL25(1)
------>AHL25(2)
-------AHL20(3)
------>AHL25(3)
------>AHL12(3)   <---------YAB5
------>AHL20(3)<---------AHL20(2)
----->AHL12(2)<---------YAB1
-----------AGL15  <---------------AtSPL8     <---------AtLEC2
----YAB1--------->AHL20(3)  <xxxxxxxxxxxxxxxxxxxsmallRNA(se3)
-->AHL25(1)<---------YAB1 xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(i2)                             <--------
---AHL25(2)--------->AHL25(3)        ------>MYB46(1)                                       ---------
-->AHL20(3)<---------AHL20(2)        ------>MYB83    --------->KAN1xxxxxxxxxxxxxxxxxxxxxxx>smallRNA(si3)
---AHL20(2)--------->AHL25(1)      <---------MYB111(1)      <----------DOF2------>ZmHOX2a(1)
-->AHL20(2)--------->AHL25(2)  <xxxxxxxxxxxxxxxxxxxxxxxsmallRNA(si3) ------>ZmHOX2a(1)<----------DOF2
---AHL25(1)<---------AHL20(3)--------->YAB5 <-------TEIL   <---------DOF5.7(1)      ---------->ID1
 
attaatagtaaaatattattaatggtactctatgagtaccaactatgtgcatgctctcatgcgctttccttcctcatcctatggtttgtctttcatctcc  16568200
                   --------->TOE2(3)
                  <---------YAB5
                --------->YAB1
               --------->KAN4(1)
               <---------KAN1
               <---------KAN4(1)                                         --------->TOE2(3)
               <---------AHL12(1)                                     <---------ALFIN1
               --------->AHL12(1)                            --------->YAB1            <---------WOX13(2)
      --------->RVE1(2)              --------->DOF5.7(1)    <---------KAN1   ---------->DOF2
-At4g35610    <---------KAN4(2)      ---------->DOF2--------->O2      ----------->RAV1(1) ----------
>At4g35610   --------->YAB1   ---------->DOF2    ---------->CDC5---------->DOF2--------->DOF5.7(1)
 
cattttgcatatgtaagaataatcttagaggctaaaagaaaaaagaatgggctcaacgtgagaataagaaagcccacattaaaagaggtctattaaagcc  16568300
                 --------------->AtSPL8                                                         ----
                <-----------TBP                                                                 ----
              <---------AHL25(1)                                   --------->YAB1             <-----
              <---------AHL20(2)                                   <---------ICU4           <-------
              --------->AHL20(2)                                   --------->YAB5          <--------
              <---------AHL25(3)                                   -------->HAHB4          ---------
              --------->AHL25(1)                                   --------->ATHB12        ---------
             <---------AHL20(2)                                   <---------ATHB12         ---------
             --------->AHL25(3)                                   --------->ICU4           ---------
            <---------AHL12(2) ------->TEIL                       <---------YAB1        ------->TEIL
            --------->AHL12(2) --------->GATA12                   <---------YAB5       --------->ARR11(2)
         <---------MYB52(1)   <---------CCA1(2)                  <---------TOE2(3)   --------->ANAC46
       ----------->GT1   <----------DOF2  <-----------GT1       --------->YAB1   --------->GLK1(1)
    <---------RVE1(2)   <---------DAG2  <----------DOF2  ----------->HVH21       --------->KAN1-----
    --------->GATA12---------->ID1      <---------DAG2 <---------ANAC58          <---------GLK1(1)
>DOF2 ------>ZmHOX2a(2) <---------DOF5.7(1)   *TSS     <---------ANAC58 <-----------GT1<---------ARR11(2)
 
catatttgatccgttatttatttgtagccttttgaatcttctactttacatttcccttccttgacattaatgattaaaccagtgatacccgaacccgaca  16568400
                                                                             <-------GAMYB
                                                                            <---------MYB46(3)
                            <---------ZAT2                                  <---------DEAR3(2)
                            --------->ZAT2                                 <---------DEAR3(1)
                           ------->TEIL                                   <------NtERF2
                        --------->ANAC58                                  --------->ATERF1(1)
                        --------->ANAC58                                  --------->DEAR4(2)
                      ------>NtERF2                                      <---------RRTF1(1)
                      <---------ATERF1(1)                                <---------RAP2.3(1)
                     ----------->HVH21                                   <---------ERF1
                    --------->ATERF1(1)                                  <---------RAP2.6(1)
--------->GLK1(2)   <------NtERF2                                        ------------>AtMYB77
--------->ARR14(2) --------->LBD16                                       <---------ATERF1(1)
<---------ARR11(2) ------>NtERF2                                         ------>NtERF2
<---------ARR14(2) <---------ATERF1(1)                                  --------->DEAR3(1)
--------->ARR11(2)<---------ANAC46                                      <---------RAP2.3(2)
--------->GATA12  --------->DEAR3(1)                                   --------->ATERF1(1)
<---------GATA12 --------->ATERF1(1)                                   --------->RAP2.3(1)
--------->RVE1(2)<---------LBD16                                     --------->ANAC46
----->ANAC58    ------>NtERF2                                       <---------LBD16
----->ANAC58   --------->ANAC46                                     <---------At5g28300
----ALFIN1  --------->ARR14(2)                                 <---------AHL12(1)
----HVH21   --------->ARR11(2)          --------->LBD16        --------->AHL12(1)
-ETT(1)     <---------GATA12<---------At4g35610               --------->AHL12(2)
>ANAC46     <---------ARR11(2)          ------>NtERF2         <---------AHL12(2)
-->HVH21    <---------ARR14(2)         --------->ANAC46   --------->At5g28300<---------MYB52(1)
>ANAC58     --------->RVE1(2)          --------->DEAR3(1)------->GAMYB<---------ATERF1(1)     ------
>ANAC58     --------->GATA12--------->At4g35610   <----------DOF2  <-----------GT1       <---------DOF5.7(1)
->NtERF2    --------->GLK1(2)         --------->SPL7(1)  ----------->GT1<---------DEAR3(1)<---------
 
ccgaatccgattcaaaatccgccggggacgcagctactccctccgccaaatagctttcaacggtaaattttcacggcgccggttgtcttccttctttgtt  16568500
                                       --------->ANAC58
                                       --------->ANAC58                                     <-------
                      --------->TOE2(3)--------->ANAC46                                ------>ZmHOX2a(2)
              <---------WOX13(1)    <-------TEIL                                <---------ZAT2
             --------->WOX13(2)    --------->CCA1(2)             <---------ARR11(2)    <---------DOF5.7(1)
     --------->ARR14(2)           --------->ARR14(2)   <------ZmHOX2a(2)        --------->ZAT2
     <---------GLK1(2)<---------------AGL15           --------->ARR11(3)        --------->At4g35610
     <---------ARR14(2)   <---------WOX13(2)     --------->DOF5.7(1) ----------->GT1 <---------ARR11(3)
    <------ZmHOX2a(1) --------------->AGL15    ---------->DOF2   --------->ARR11(2)  --------->GATA12
 <---------LBD16--------->YAB1    <---------ARR14(2)  <---------ARR11(3)        <---------At4g35610
---->ID1     <---------WOX13(2)   <---------ARR11(2)  --------->RVE1(2)      <---------At4g35610
-DOF2--------->ARR11(2)   --------->WOX13(2)   --------->DOF5.7(1)--------->MYB52(1) <---------GATA12
 
cttctcaggaatcgctaattgataacttcaattggaagatacaagacaaaaaaagaagatcaatatgggaaacggtattaagcagctcgatcttactgat  16568600
                                                            ---------->DOF2
                                                          ----------->HVH21
                                                        <---------At4g35610
                                                  <---------MYB46(3)      ------>MYB83
                                                 <---------MYB52(1)       ------>MYB46(1)
                                                <-------GAMYB           <---------MYB59
                                               ===================RAV <---------ARR11(3)
           <---------ANAC58                    <-----------RAV1(1)    --------->ARR11(3)
           <---------ANAC58                 <---------ARR14(2)    <------ZmHOX2a(1)
 <---------ANAC58                <---------ARR14(2)     --------->At4g35610
 <---------ANAC58     ---------->DOF2       --------->ARR14(2)--------->DOF5.7(1)          <--------
--YAB5   --------->ARR11(3)   ----------------->AGL1  <-----------RAV1(2) --------->MYB52(1)    <---
 
ttttgcttagtttatcttgccaaacaaaagtatgccaatactgtgaagttctgttgttcaggtgaaagaggaagacctaacaagaagatgaagtatggtg  16568700
                                 <---------AHL20(2)
                                --------->AHL25(3)
                                <---------AHL20(2)
                               --------->AHL12(2)
                               <---------AHL12(2)
                             <---------AHL12(1)
                             --------->AHL20(2)                                                  <--
                             --------->AHL12(1)                                               <-----
                             --------->AHL25(3)                                           <---------
                             <---------AHL25(2)                --------->MYB111(1)        --------->RVE1(2)
                             <---------AHL20(2)                <---------MYB46(3)         --------->GATA12
                             --------->AHL25(2)                --------->MYB111(2)        <---------GATA12
   <-------TEIL              --------->AHL25(1)          <---------At4g35610             <---------CCA1(2)
<---------HSFC1(2)      <------ZmHOX2a(2)    <---------ICU4 ----------->GT1   <---------YAB5  <-----
--------->HSFC1(2)     --------->AGP1<---------AHL20(2)<-----------RAV1(2)    <---------------AtSPL8
<---------HSFB2a(1)    <---------ARR11(3)  <---------WOX13(2)  --------->MYB46(2)    <-----------HVH21
--------->HSFB2a(1)    --------->GATA12    --------->WOX13(2) <--------P      <---------------AtSPL3
-AtMYB61   <---------GLK1(2) --------->AHL20(3)  <---------ZAT18     <---------YAB5 ----------->GT1
---NtERF2<---------YAB1--------->RVE1(2)  --------->WOX13(1)------------>MYB.PH3(2) <---------ZAT6
 
gcaaggttcgtcttgattcttctccagatcaattttttattttatcaattagggctcttcagatggtagttagtgagtgtaattgtactgtcaaatctca  16568800
<- Previous    Next ->

AGI:  At5g41370.1   
Description:  XPB1 (ARABIDOPSIS HOMOLOG OF XERODERMA PIGMENTOSUM COMPLEMENTATION GROUP B 1); ATP-dependent helicase. Identical to DNA repair helicase XPB1 (XPB1) [Arabidopsis Thaliana] (GB:Q38861;GB:O04171;GB:Q6JA92;GB:Q9FN63); similar to XPB2 (ARABIDOPSIS HOMOLOG OF XERODERMA PIGMENTOSUM COMPLEMENTATION GROUP B 2), ATP-dependent helicase [Arabidopsis thaliana] (TAIR:AT5G41360.1); similar to hypothetical protein OsJ_002992 [Oryza sativa (japonica cultivar-group)] (GB:EAZ13167.1); similar to unnamed protein product [Vitis vinifera] (GB:CAO65934.1); similar to hypothetical protein OsI_003293 [Oryza sativa (indica cultivar-group)] (GB:EAY75446.1); contains I
Range:  from: 16568347    to: 16573231    Orientation: Forward
Links:  TAIR  MIPS  AIP 
 
 
Please cite the corresponding publications when using AthaMap.

    printer-friendly version